Western swamp turtle, Reference Genome, Illumina-HiC, Muscle
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2026-02-10 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | Location information restricted |
| ala_specimen_url | https://bie.ala.org.au/species/https://biodiversity.org.au/afd/taxa/8308a376-50a5-483b-ac9f-39d702b817ec |
| analysis_software | DRAGEN BCLconvert |
| analysis_software_version | 4.1.23 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1744/ |
| bioplatforms_project | Threatened Species Initiative |
| birth_date | 2024-06-04 |
| ccg_jira_ticket | BPAOPS-1744 |
| certainty | not determined |
| class | Reptilia |
| collection_date | 2024-08-08 |
| collector | Perth Zoo |
| common_name | Western swamp turtle |
| country | Australia |
| data_context | Reference Genome |
| data_custodian | Carolyn Hogg |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/419496 |
| date_of_transfer | 2025-02-10 |
| date_of_transfer_to_archive | 2025-02-11 |
| death_date | 2024-08-08 |
| dna_treatment | FA crosslinking |
| facility_project_code | NA |
| facility_sample_id | 417573_TSI_BRF_22KYTHLT4_CCAGTTGA |
| family | Chelidae |
| flowcell_id | 22KYTHLT4 |
| flowcell_type | NovaSeq X 25B |
| folder_name | 20250210_TSI_BRF_419496_22KYTHLT4 |
| genus | Pseudemydura |
| insert_size_range | ~600bp |
| institution_name | Department of Biodiversity, Conservation and Attractions |
| library_construction_protocol | HiC Arima 2.0 |
| library_id | 417573 |
| library_index_id | NEB_Set1_D11 |
| library_index_seq | CCAGTTGA |
| library_layout | Paired end |
| library_location | BRF Freezer |
| library_ng_ul | 1.3 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAGTTGA(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 7 |
| library_pcr_reps | 1 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction digest |
| library_source | GENOMIC |
| library_strategy | HiC |
| library_type | illumina-hic |
| lifestage | juvenile stage |
| location_text | Perth Zoo |
| material_extracted_by | BRF |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-09-05 |
| metadata_revision_filename | 20250904_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | not determined |
| n_libraries_pooled | 1 |
| order | Testudines |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | None |
| sample_custodian | Kym Ottewell | DBCA |
| sample_id | 102.100.100/704513 |
| sample_quality | good |
| sample_type | Tissue sample |
| scientific_name | Pseudemydura umbrina |
| scientific_name_authorship | Siebenrock, 1901 |
| sequencing_facility | BRF |
| sequencing_model | NovaSeq X |
| sequencing_platform | Illumina |
| source_population | Sire captive bred, dam wild caugh Elllenbrook Nature Reserve |
| species | umbrina |
| specimen_id | C40075 |
| specimen_id_description | Perth Zoo sample |
| state_or_region | Western Australia |
| taxon_id | 44510 |
| taxonomic_group | Testudine |
| ticket | BPAOPS-1744 |
| tissue_collection | DBCA |
| tissue_collection_type | Zoo living collection |
| tissue_number | T17916 |
| tissue_preservation | flash frozen |
| tissue_preservation_temperature | -80.0 |
| tissue_type | Muscle |
| wild_captive | captive |
| work_order | 14082 |