Eastern Barred Bandicoot, Reference Genome, Illumina-HiC, Heart
Dataset size is: 0.00 b
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2026-02-10 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | open |
| ala_specimen_url | https://bie.ala.org.au/species/https://biodiversity.org.au/afd/taxa/03b41280-eed3-4244-bf2e-bc8f7c30b3df |
| analysis_software | DRAGEN BCLconvert |
| analysis_software_version | 4.1.23 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1743/ |
| bioplatforms_project | Threatened Species Initiative |
| ccg_jira_ticket | BPAOPS-1743 |
| certainty | High |
| class | Mammalia |
| collection_date | 2023-11-04 |
| collection_method | Dissection |
| collector | Carolyn Hogg |
| common_name | Eastern Barred Bandicoot |
| country | Australia |
| data_context | Reference Genome |
| data_custodian | Carolyn Hogg |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/419495 |
| date_of_transfer | 2025-02-10 |
| date_of_transfer_to_archive | 2025-02-11 |
| death_date | 2023-06-03 |
| decimal_latitude_public | -37.9 |
| decimal_longitude_public | 144.4 |
| dna_treatment | FA crosslinking |
| facility_project_code | NA |
| facility_sample_id | 417572_TSI_BRF_22KYTHLT4_GAACGGTT |
| family | Peramelidae |
| flowcell_id | 22KYTHLT4 |
| flowcell_type | NovaSeq X 25B |
| folder_name | 20250210_TSI_BRF_419495_22KYTHLT4 |
| genotypic_sex | Female |
| genus | Perameles |
| habitat | Grasslands |
| health_state | Found dead |
| insert_size_range | ~600bp |
| institution_name | The University of Melbourne |
| latitude | -37.9 |
| library_construction_protocol | HiC Arima 2.0 |
| library_id | 417572 |
| library_index_id | NEB_Set1_C11 |
| library_index_seq | GAACGGTT |
| library_layout | Paired end |
| library_location | BRF Freezer |
| library_ng_ul | 1.3 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAACGGTT(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 7 |
| library_pcr_reps | 1 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction digest |
| library_source | GENOMIC |
| library_strategy | HiC |
| library_type | illumina-hic |
| lifestage | Adult |
| longitude | 144.4 |
| material_extracted_by | BRF |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-09-05 |
| metadata_revision_filename | 20250904_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | Dissection |
| n_libraries_pooled | 1 |
| order | Marsupialia |
| phenotypic_sex | Female |
| phylum | Chordata |
| prior_genetics | HiFi |
| sample_custodian | Carolyn Hogg |
| sample_id | 102.100.100/415569 |
| sample_quality | good |
| sample_type | Organ |
| scientific_name | Perameles gunnii |
| sequencing_facility | BRF |
| sequencing_model | NovaSeq X |
| sequencing_platform | Illumina |
| source_population | Mt Rothwell |
| species | gunnii |
| specimen_id | Umelb_EBB |
| specimen_id_description | University of Melbourne sample |
| state_or_region | Victoria |
| taxon_id | 37737.0 |
| taxonomic_group | Marsupial |
| ticket | BPAOPS-1743 |
| tissue_collection | The University of Sydney |
| tissue_collection_type | Dissection |
| tissue_number | Umelb_EBB_heart |
| tissue_preservation | Flash frozen |
| tissue_preservation_temperature | -80.0 |
| tissue_type | Heart |
| wild_captive | wild |
| work_order | 14082 |