kowari, Reference Genome, Illumina-HiC, heart
Dataset size is: 0.00 b
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2026-02-10 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | Open |
| ala_specimen_url | https://bie.ala.org.au/species/https://biodiversity.org.au/afd/taxa/c342ff42-9ee4-41f6-8365-62b15c4d27f2 |
| analysis_software | DRAGEN BCLconvert |
| analysis_software_version | 4.1.23 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1741/ |
| bioplatforms_project | Threatened Species Initiative |
| ccg_jira_ticket | BPAOPS-1741 |
| certainty | low |
| class | Mammalia |
| collection_method | Dissection |
| collector | South Australian Museum |
| collector_sample_id | ABTC7553 |
| common_name | kowari |
| country | Australia |
| data_context | Reference Genome |
| data_custodian | Carolyn Hogg |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/419492 |
| date_of_transfer | 2025-02-10 |
| date_of_transfer_to_archive | 2025-02-11 |
| dna_treatment | FA crosslinking |
| facility_project_code | NA |
| facility_sample_id | 417569_TSI_BRF_22KYTHLT4_GTACACCT |
| family | Dasyuridae |
| flowcell_id | 22KYTHLT4 |
| flowcell_type | NovaSeq X 25B |
| folder_name | 20250210_TSI_BRF_419492_22KYTHLT4 |
| genotypic_sex | not determined |
| genus | Dasyuroides |
| habitat | habitat |
| health_state | unknown |
| insert_size_range | ~600bp |
| institution_name | University of Sydney |
| library_construction_protocol | HiC Arima 2.0 |
| library_id | 417569 |
| library_index_id | NEB_Set1_A11 |
| library_index_seq | GTACACCT |
| library_layout | Paired end |
| library_location | BRF Freezer |
| library_ng_ul | 1.3 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTACACCT(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 7 |
| library_pcr_reps | 1 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction digest |
| library_source | GENOMIC |
| library_strategy | HiC |
| library_type | illumina-hic |
| lifestage | Adult |
| material_extracted_by | BRF |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-09-05 |
| metadata_revision_filename | 20250904_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| n_libraries_pooled | 1 |
| order | Dasyuromorphia |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | HiFi |
| sample_custodian | Carolyn Hogg |
| sample_id | 102.100.100/415566 |
| sample_quality | high |
| sample_type | organ |
| scientific_name | Dasyuroides byrnei |
| sequencing_facility | BRF |
| sequencing_model | NovaSeq X |
| sequencing_platform | Illumina |
| species | byrnei |
| specimen_id | TT590 |
| specimen_id_description | South Australian Museum |
| state_or_region | South Australia |
| taxon_id | 32544 |
| taxonomic_group | Marsupial |
| ticket | BPAOPS-1741 |
| tissue_collection | Dissection |
| tissue_number | ABTC7553_heart |
| tissue_preservation | frozen |
| tissue_preservation_temperature | -80.0 |
| tissue_type | heart |
| wild_captive | captive |
| work_order | 14082 |