Butterfly pea, Reference genome (HiC), Illumina-HiC, Aerial shoots
Dataset size is: 0.00 b
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2023-07-13 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | No restrictions |
| ala_specimen_url | NA |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1309/20220711_TSI_BRF_HG5YLDMXY/ |
| birth_date | 2022-05-09 |
| ccg_jira_ticket | BPAOPS-1309 |
| certainty | Certain |
| class | Angiospermae |
| collection_date | 2022-06-06 |
| collection_method | Cultivated |
| collector | Edward Gilding |
| common_name | Butterfly pea |
| country | Australia |
| data_context | Reference genome (HiC) |
| data_custodian | Carolyn Hogg |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/358787 |
| date_of_transfer | 2022-07-13 |
| date_of_transfer_to_archive | 2022-08-09 |
| decimal_latitude_public | -27.5 |
| decimal_longitude_public | 153.0 |
| description | Hi-C multiple species |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| download | researcher informed |
| experimental_design | Arima HiC 2.0 single index |
| facility_project_code | BRF |
| facility_sample_id | 408045_AusARG_BRF_XXXXX_GTGAAA |
| family | Fabaceae |
| file_type | FASTQ |
| flowcell_id | HG5YLDMXY |
| flowcell_type | Novaseq S2 |
| folder_name | 20220711_TSI_BRF_HG5YLDMXY |
| genotypic_sex | Hermaphrodite |
| genus | Clitoria |
| habitat | Open fields and woodland |
| health_state | Healthy |
| insert_size_range | 150bp PE |
| institution_name | The University of Queensland Institute for Molecular Bioscience |
| latitude | -27.5 |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 408045 |
| library_index_id | Index_19 |
| library_index_seq | GTGAAA |
| library_layout | paired end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.6 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAA(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 6 |
| library_pcr_reps | 1 |
| library_prep_date | 2022-06-30 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | Illumina-HiC |
| lifestage | juvenile plant |
| location_text | Historical collection of feral populations |
| longitude | 153.0 |
| material_conc_ng_ul | unknown |
| material_extracted_by | Edward Gilding |
| material_extraction_method | unknown; sample extraction done by BRF |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-09-05 |
| metadata_revision_filename | 20250904_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | not determined |
| n_libraries_pooled | 6 |
| order | Fabales |
| phenotypic_sex | hermaphrodite |
| phylum | Embryophyta |
| prior_genetics | Prior transcriptomic sequencing and expression profiling performed and detailed in: https://doi.org/10.1111/nph.13789; genome dequencing in progress |
| sample_custodian | David Craik, Edward Gilding |
| sample_id | 102.100.100/415482 |
| sample_quality | Flash frozen shoots stored at -80C, suspect no degradation of gDNA. |
| sample_type | Whole organism |
| scientific_name | Clitoria ternatea 'Milgarra' UQSEQ001 |
| scientific_name_authorship | Linneaus |
| scientific_name_note | Note: there is no place for accession or cultivar thus the cv name 'Milgarra' and accession thereof "UQ-SEQ001" is given in the full name field. |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | NovaSeq v1.5 |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| source_population | Cultivated |
| species | ternatea |
| specimen_id | UQ_CT_SEQ001.3 |
| specimen_id_description | University of Queensland Clitoria ternatea sequenced accession #1 inbred generation 3 |
| state_or_region | Queensland |
| subspecies | n/a |
| taxon_id | 43366 |
| taxonomic_group | Plant |
| ticket | BPAOPS-1309 |
| tissue_collection | DC |
| tissue_collection_type | Living collection |
| tissue_number | UQ_CT_SEQ001.3_shoots |
| tissue_preservation | Frozen |
| tissue_preservation_temperature | "-80C" |
| tissue_type | Aerial shoots |
| type_status | unknown |
| wild_captive | captive |
| work_order | 13045 |