Butterfly pea, Reference genome (HiC), Illumina-HiC, Aerial shoots

408045 Clitoria ternatea, Australia Queensland

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members
Access Control Date 2023-07-13
Access Control Mode date
Sequence Data Type illumina-hic
access_rights No restrictions
ala_specimen_url NA
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1309/20220711_TSI_BRF_HG5YLDMXY/
birth_date 2022-05-09
ccg_jira_ticket BPAOPS-1309
certainty Certain
class Angiospermae
collection_date 2022-06-06
collection_method Cultivated
collector Edward Gilding
common_name Butterfly pea
country Australia
data_context Reference genome (HiC)
data_custodian Carolyn Hogg
data_type Illumina-HiC
dataset_id 102.100.100/358787
date_of_transfer 2022-07-13
date_of_transfer_to_archive 2022-08-09
decimal_latitude_public -27.5
decimal_longitude_public 153.0
description Hi-C multiple species
dna_treatment FA crosllinking restriction enzymes and sonication
download researcher informed
experimental_design Arima HiC 2.0 single index
facility_project_code BRF
facility_sample_id 408045_AusARG_BRF_XXXXX_GTGAAA
family Fabaceae
file_type FASTQ
flowcell_id HG5YLDMXY
flowcell_type Novaseq S2
folder_name 20220711_TSI_BRF_HG5YLDMXY
genotypic_sex Hermaphrodite
genus Clitoria
habitat Open fields and woodland
health_state Healthy
insert_size_range 150bp PE
institution_name The University of Queensland Institute for Molecular Bioscience
latitude -27.5
library_comments Concentration and size was assesd by Bioanalyzer and Qubit
library_construction_protocol Arima HiC 2.0
library_id 408045
library_index_id Index_19
library_index_seq GTGAAA
library_layout paired end
library_location Freezer at BRF
library_ng_ul 1.6
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAA(AT)CTCGTATGCCGTCTTCTGCTTG
library_pcr_cycles 6
library_pcr_reps 1
library_prep_date 2022-06-30
library_prepared_by Max Nekrasov
library_selection Restriction Digest
library_source GENOMIC
library_strategy Hi-C
library_type Illumina-HiC
lifestage juvenile plant
location_text Historical collection of feral populations
longitude 153.0
material_conc_ng_ul unknown
material_extracted_by Edward Gilding
material_extraction_method unknown; sample extraction done by BRF
material_extraction_type DNA
metadata_revision_date 2025-09-05
metadata_revision_filename 20250904_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx
method_of_determination not determined
n_libraries_pooled 6
order Fabales
phenotypic_sex hermaphrodite
phylum Embryophyta
prior_genetics Prior transcriptomic sequencing and expression profiling performed and detailed in: https://doi.org/10.1111/nph.13789; genome dequencing in progress
sample_custodian David Craik, Edward Gilding
sample_id 102.100.100/415482
sample_quality Flash frozen shoots stored at -80C, suspect no degradation of gDNA.
sample_type Whole organism
scientific_name Clitoria ternatea 'Milgarra' UQSEQ001
scientific_name_authorship Linneaus
scientific_name_note Note: there is no place for accession or cultivar thus the cv name 'Milgarra' and accession thereof "UQ-SEQ001" is given in the full name field.
sequencing_facility BRF
sequencing_kit_chemistry_version NovaSeq v1.5
sequencing_model Illumina NovaSeq 6000
sequencing_platform ILLUMINA
source_population Cultivated
species ternatea
specimen_id UQ_CT_SEQ001.3
specimen_id_description University of Queensland Clitoria ternatea sequenced accession #1 inbred generation 3
state_or_region Queensland
subspecies n/a
taxon_id 43366
taxonomic_group Plant
ticket BPAOPS-1309
tissue_collection DC
tissue_collection_type Living collection
tissue_number UQ_CT_SEQ001.3_shoots
tissue_preservation Frozen
tissue_preservation_temperature "-80C"
tissue_type Aerial shoots
type_status unknown
wild_captive captive
work_order 13045