Bellinger River snapping turtle, Reference genome (HiC), Illumina-HiC, Heart
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2023-07-13 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | Open Access |
| ala_specimen_url | https://bie.ala.org.au/species/urn:lsid:biodiversity.org.au:afd.taxon:4f95257b-a79e-452a-bc1e-9f512d8fd878 |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1309/20220711_TSI_BRF_HG5YLDMXY/ |
| ccg_jira_ticket | BPAOPS-1309 |
| certainty | Certain |
| class | Reptilia |
| collection_date | 1986-04-08 |
| collection_method | Medical euthanasia |
| collector | Arthur Georges |
| collector_sample_id | C10031 |
| common_name | Bellinger River snapping turtle |
| country | Australia |
| data_context | Reference genome (HiC) |
| data_custodian | Carolyn Hogg |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/358784 |
| date_of_transfer | 2022-07-13 |
| date_of_transfer_to_archive | 2022-08-09 |
| death_date | 2021-05-25 |
| decimal_latitude_public | -33.8 |
| decimal_longitude_public | 151.2 |
| description | Hi-C multiple species |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| download | researcher informed |
| experimental_design | Arima HiC 2.0 single index |
| facility_project_code | BRF |
| facility_sample_id | 408042_AusARG_BRF_XXXXX_AGTCAA |
| family | Chelidae |
| file_type | FASTQ |
| flowcell_id | HG5YLDMXY |
| flowcell_type | Novaseq S2 |
| folder_name | 20220711_TSI_BRF_HG5YLDMXY |
| genus | Myuchelys |
| habitat | Aquatic |
| health_state | Poor |
| insert_size_range | 150bp PE |
| institution_name | University of Sydney |
| latitude | -33.8 |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 408042 |
| library_index_id | Index_13 |
| library_index_seq | AGTCAA |
| library_layout | paired end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.6 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAA(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 6 |
| library_pcr_reps | 1 |
| library_prep_date | 2022-06-30 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | Illumina-HiC |
| lifestage | adult |
| location_text | Mosman |
| longitude | 151.2 |
| metadata_revision_date | 2025-09-05 |
| metadata_revision_filename | 20250904_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | Dissection |
| n_libraries_pooled | 6 |
| order | Testudines |
| phenotypic_sex | male |
| phylum | Chordata |
| prior_genetics | DArTseq |
| sample_custodian | Carolyn Hogg |
| sample_id | 102.100.100/405731 |
| sample_quality | Good |
| sample_type | Organ |
| scientific_name | Myuchelys georgesi |
| scientific_name_authorship | Arthur Georges |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | NovaSeq v1.5 |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| source_population | Taronga Zoo |
| species | georgesi |
| specimen_id | C10031 |
| specimen_id_description | Taronga Zoo ID |
| state_or_region | New South Wales |
| taxon_id | 1041117 |
| taxonomic_group | Reptile |
| ticket | BPAOPS-1309 |
| tissue_collection | Euthanasia |
| tissue_collection_type | Living collection - zoo |
| tissue_number | C10031_heart |
| tissue_preservation | Flash frozen |
| tissue_preservation_temperature | "-80C" |
| tissue_type | Heart |
| wild_captive | captive |
| work_order | 13045 |