green and golden bell frog, Reference genome (HiC), Illumina-HiC, muscle structure

408028 Litoria aurea, Australia New South Wales

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members
Access Control Date 2024-07-31
Access Control Mode date
Sequence Data Type illumina-hic
access_rights no restrictions
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1309/20220711_TSI_BRF_HG5YLDMXY/
ccg_jira_ticket BPAOPS-1309
certainty certain
class Amphibia
collection_method Frog was removed from outdoor enclosure by hand
collector Anthony Waddle, University of Melbourne/Macquarie University
collector_sample_id MaleTub17
common_name green and golden bell frog
country Australia
data_context Reference genome (HiC)
data_custodian Anthony Wardle
data_type Illumina-HiC
dataset_id 102.100.100/358779
date_of_transfer 2022-07-13
date_of_transfer_to_archive 2022-08-09
description Hi-C multiple species
dna_treatment FA crosllinking restriction enzymes and sonication
download researcher informed
experimental_design Arima HiC 2.0 single index
facility_project_code BRF
facility_sample_id 408028_AusARG_BRF_XXXXX_GTCCGC
family Pelodryadidae
file_type FASTQ
flowcell_id HG5YLDMXY
flowcell_type Novaseq S2
folder_name 20220711_TSI_BRF_HG5YLDMXY
genus Litoria
habitat Waste emplacement dam
insert_size_range 150bp PE
institution_name Macquarie University
library_comments Concentration and size was assesd by Bioanalyzer and Qubit
library_construction_protocol Arima HiC 2.0
library_id 408028
library_index_id Index_18
library_index_seq GTCCGC
library_layout paired end
library_location Freezer at BRF
library_ng_ul 1.6
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGC(AT)CTCGTATGCCGTCTTCTGCTTG
library_pcr_cycles 6
library_pcr_reps 1
library_prep_date 2022-06-30
library_prepared_by Max Nekrasov
library_selection Restriction Digest
library_source GENOMIC
library_strategy Hi-C
library_type Illumina-HiC
lifestage adult organism
location_text Kooragang Island
material_extracted_by Anthony Waddle
material_extraction_type DNA
metadata_revision_date 2025-09-05
metadata_revision_filename 20250904_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx
method_of_determination conspicuous sexual characteristics such as nuptual pads and coloured throat patch.
n_libraries_pooled 6
order Anura
phenotypic_sex male
phylum Chordata
sample_custodian Anthony Waddle, Rick Shine, Simon Clulow
sample_id 102.100.100/405646
sample_quality Flash Frozen
sample_type tissue sample
scientific_name Litoria aurea
scientific_name_authorship Lesson, 1829
scientific_name_note sometimes called Ranoidea aurea
sequencing_facility BRF
sequencing_kit_chemistry_version NovaSeq v1.5
sequencing_model Illumina NovaSeq 6000
sequencing_platform ILLUMINA
source_population Kooragang Island
species aurea
specimen_id 356208.0
specimen_id_description Specimen is a male Litoria aurea from Macquarie University Fauna Park Colony taken from tub 17 in July 2021
state_or_region New South Wales
subspecies n/a
taxon_id 312085.0
taxonomic_group Amphibian
ticket BPAOPS-1309
tissue_collection MQ-MLA017
tissue_collection_type university
tissue_number MQ-MLA017Muscle
tissue_preservation -80C
tissue_preservation_temperature -80C
tissue_type muscle structure
wild_captive captive
work_order 13045