Orange-bellied Parrot, Population Genetics, Illumina ddRAD-seq, blood on filter paper
Dataset size is: 0.00 b
Data and Resources
-
629192_TSI_AGRF_233JLLLT3_ACAGTG... Metadata Only FASTQ
-
TSI_233JLLLT3_629192_library_met... Metadata Only XLSX
-
629192_TSI_AGRF_233JLLLT3_GTGAAA... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_GCCAAT... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_TGACCA... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_ACAGTG... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_CGATGT... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_CGATGT... Metadata Only FASTQ
-
TSI_233JLLLT3_629192_samplemetad... Metadata Only XLSX
-
629192_TSI_AGRF_233JLLLT3_GCCAAT... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_CTTGTA... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_CTTGTA... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_GTGAAA... Metadata Only FASTQ
-
629192_TSI_AGRF_233JLLLT3_TGACCA... Metadata Only FASTQ
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2026-06-11 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| Related Data | Attached metadata spreadsheets were produced when data was generated. |
| ala_specimen_url | NA |
| bait_set_name | Restriction Digest |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1795/20250611_TSI_AGRF_233JLLLT3/ |
| bioplatforms_project | Threatened Species Initiative |
| birth_date | 2021-01-13 |
| bpa_dataset_id | 102.100.100/629192 |
| class | Aves |
| collection_date | 2021-01-01 |
| common_name | Orange-bellied Parrot |
| country | Australia |
| data_context | Population Genetics |
| data_custodian | Soleille Miller |
| data_type | Illumina ddRAD-seq |
| dataset_id | 102.100.100/629192 |
| date_of_transfer | 2025-06-11 |
| date_of_transfer_to_archive | 2025-06-12 |
| experimental_design | PstI/HpyCH4IV |
| facility_project_code | CAGRF25030231 |
| family | Psittaculidae |
| flowcell_id | 233JLLLT3 |
| flowcell_type | 10B |
| folder_name | 20250611_TSI_AGRF_233JLLLT3 |
| genus | Neophema |
| insert_size_range | 280-342 |
| institution_name | AM/USYD/ANU |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2025-06-02 |
| library_prepared_by | Lachlan Soraru |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | ddRAD |
| location_text | Australia, Tasmania, Ex Dpi Captive Breeding Program, Taroona (47� 57' S, 147� 20' E) |
| material_conc_ng_ul | 36.4 |
| material_extracted_by | Kim_Heasman |
| material_extraction_date | 2025-04-15 |
| material_extraction_method | salting out |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-09-05 |
| metadata_revision_filename | 20250904_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| n_libraries_pooled | 6.0 |
| order | Psittaciformes |
| phenotypic_sex | Female |
| phylum | Animalia |
| prior_genetics | NCBI genome accession number GCA_047054915.1, whole genome historical analysis doi:10.1111/mec.17892 |
| sample_custodian | Australian Museum |
| sample_type | tissue |
| scientific_name | Neophema chrysogaster |
| scientific_name_authorship | Latham, 1936 |
| scientific_name_note | first described by Latham as Psittacus chrysogaster, Tommaso Salvadori erected the new genus Neophema in 1891, placing the orange-bellied parrot within it and gave it its current scientific name |
| sequencing_facility | AGRF_Perth |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| source_population | wild |
| species | chrysogaster |
| specimen_id | O.84823.001 |
| specimen_id_description | Australian Museum sample registration number |
| state_or_region | Tasmania |
| taxon_id | 678581.0 |
| ticket | BPAOPS-1795 |
| tissue_collection | Australian Museum Frozen Tissue Collection |
| tissue_collection_type | museum |
| tissue_number | AM_84823 |
| tissue_preservation | frozen, dried |
| tissue_preservation_temperature | -80.0 |
| tissue_type | blood on filter paper |
| wild_captive | wild |
| work_order | NA |