Richmond birdwing, Population Genetics, None, entire individual
Dataset size is: 0.00 b
This dataset is under an embargo to enable primary access by research partners.
If you would like access this data please contact us here or contact the project lead directly (see details in the table below) for information about the embargo.
The embargo is for the following reason:
Unable to determine correct embargo period.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Reason | Unable to determine correct embargo period. |
| Access Control Mode | closed |
| Sequence Data Type | illumina-ddrad |
| Related Data | Attached metadata spreadsheets were produced when data was generated. |
| access_rights | Location information restricted |
| ala_specimen_url | NA |
| ancillary_notes | second instar |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1955/20251105_TSI_AGRF_2372CVLT3/ |
| bioplatforms_project | Threatened Species Initiative |
| bpa_dataset_id | 102.100.100/629185 |
| class | Insecta |
| collection_date | 2025-02-26 |
| collection_method | hand capture |
| collector | Hunter McCall, DETSI |
| collector_sample_id | IG25-096 |
| common_name | Richmond birdwing |
| country | Australia |
| data_context | Population Genetics |
| data_custodian | Hunter McCall |
| dataset_id | 102.100.100/629185 |
| death_date | 2025-02-26 |
| decimal_latitude_public | -27.9 |
| decimal_longitude_public | 153.1 |
| experimental_design | EcoRI/MspI |
| facility_project_code | CAGRF25040331 |
| family | Papilionidae |
| flowcell_id | 2372CVLT3 |
| flowcell_type | 10B |
| genotypic_sex | not determined |
| genus | Ornithoptera |
| health_state | unknown |
| insert_size_range | 280 - 375bp |
| institution_name | Department of Environment, Tourism, Science and Innovation |
| latitude | -27.9 |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prepared_by | Jeremy Beerkens |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | illumina-ddrad |
| lifestage | larva |
| location_text | Tamborine Rainforest Skywalk |
| longitude | 153.1 |
| material_conc_ng_ul | NA |
| material_extracted_by | NA |
| material_extraction_method | NA |
| material_extraction_type | NA |
| metadata_revision_date | 2025-09-05 |
| metadata_revision_filename | 20250904_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| n_libraries_pooled | 2.0 |
| order | Lepidoptera |
| phenotypic_sex | not determined |
| phylum | Arthropoda |
| prior_genetics | NA |
| sample_custodian | Ian Gynther, DETSI |
| sample_quality | good |
| sample_type | whole organism |
| scientific_name | Ornithoptera richmondia |
| scientific_name_authorship | Gray, 1853 |
| sequencing_facility | AGRF_Melbourne |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| species | richmondia |
| specimen_id | IG25-096 |
| specimen_id_description | field number assigned by specimen collector |
| state_or_region | Gold Coast |
| taxon_id | 2064775.0 |
| taxonomic_group | insect |
| ticket | BPAOPS-1955 |
| tissue_collection | wild_caught |
| tissue_collection_type | free living population |
| tissue_number | IG25-096_TRSW01_whole |
| tissue_preservation | 100% ethanol |
| tissue_preservation_temperature | -20.0 |
| tissue_type | entire individual |
| type_status | NA |
| wild_captive | wild |
| work_order | 14091 |