Swan galaxias, Population Genetics, Illumina ddRAD-seq, Fin

Galaxiidae, Galaxias fontanus, GF4_2024, Fish, Project Lead: Charlotte Jensen

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members
Access Control Date 2025-08-01
Access Control Mode date
Sequence Data Type illumina-ddrad
Related Data Attached metadata spreadsheets were produced when data was generated.
access_rights No restrictions
ala_specimen_url NA
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1631/20240729_TSI_AGRF_22MN5JLT3/
bioplatforms_project Threatened Species Initiative
bpa_dataset_id 102.100.100/358844
certainty not determined
class Actinopterygii
collection_date 2024-01-16
collection_method Electrofishing
collector Rob Freeman, Bruce Deagle
common_name Swan galaxias
country Australia
data_context Population Genetics
data_custodian Charlotte Jensen
data_type Illumina ddRAD-seq
dataset_id 102.100.100/358844
date_of_transfer 2024-08-01
date_of_transfer_to_archive 2024-08-02
death_date 2024-01-16
decimal_latitude_public 41.8
decimal_longitude_public 148.1
description Galaxias ddRAD
experimental_design PstI/MseI
family Galaxiidae
flowcell_id 22MN5JLT3
flowcell_type 10B
folder_name 20240729_TSI_AGRF_22MN5JLT3
genotypic_sex not determined
genus Galaxias
habitat River
health_state unknown
insert_size_range 280-342bp
institution_name CSIRO
latitude 41.8
library_construction_protocol ddRAD (based on Peterson et al 2012)
library_layout paired end
library_location AGRF_Perth
library_oligo_sequence AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G
library_pcr_cycles 11.0
library_pcr_reps 7.0
library_prep_date 2024-07-12
library_prepared_by Daniel Brescianini
library_selection Restriction Digest
library_source GENOMIC
library_strategy RAD-Seq
library_type Illumina-ddRAD
lifestage unknown
location_text St. Pauls River (above Meadstone Falls)
longitude 148.1
material_conc_ng_ul unknown
material_extracted_by Charlotte Jense
material_extraction_method Dneasy Blood & Tissue kit
material_extraction_type DNA
metadata_revision_date 2025-09-05
metadata_revision_filename 20250904_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx
method_of_determination not determined
n_libraries_pooled 2.0
order Galaxiiformes
phenotypic_sex not determined
phylum Chordata
prior_genetics NA
sample_custodian Bruce Deagle
sample_type Tissue sample, whole organism
scientific_name Galaxias fontanus
scientific_name_authorship Fulton, 1978
sequencing_facility AGRF_Melbourne
sequencing_model NovaSeq X Plus
sequencing_platform ILLUMINA
source_population St. Pauls river
species fontanus
specimen_id GF4_2024
specimen_id_description Created by researcher as followes: the 2 letters correspond with the species name Galaxias brevipinnis and the number is unique for each sample
state_or_region Tasmania
taxon_id 66448.0
taxonomic_group Fish
ticket BPAOPS-1631
tissue_collection CSIRO National Fish Collection
tissue_number GF4_2024
tissue_preservation Ethanol, +4C
tissue_preservation_temperature 4.0
tissue_type Fin
type_status unknown
wild_captive wild
work_order 14056