Plant Pathogen, Genomics, PacBio HiFi, Sample ID 396014
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until June 17, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj046 |
| Access Control Date | 2026-06-17 |
| Access Control Mode | date |
| Sequence Data Type | pacbio-hifi |
| analysis_software | 25.1.0.257715 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/pacbio-hifi/BPAOPS-1797/20250606_PP_BRF_m84118_250606_030322_s1/ |
| bioplatforms_dataset_id | 102.100.100/399073 |
| bioplatforms_library_id | 102.100.100/398415 |
| bioplatforms_project | Plant Pathogen Initiative |
| bioplatforms_project_code | PP046_Meloidogyne |
| bioplatforms_sample_id | 102.100.100/396014 |
| ccg_jira_ticket | BPAOPS-1797 |
| cell_postion | A01 |
| class | Chromadorea |
| collection_date | 2024-11-25 |
| collector | Yennefer, A. |
| common_name | Sugarcane eelworm |
| country | Australia |
| data_context | Genomics |
| data_type | PacBio-HiFi |
| date_data_published | 24/6/2025 |
| date_of_transfer | 2025-06-17 |
| date_of_transfer_to_archive | 2025-06-18 |
| decimal_latitude_public | -27.49 |
| decimal_longitude_public | 153.02 |
| description | PacBio-HiFi |
| dna_treatment | Samples concentrated with beads prior prep |
| download | https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket%3ABPAOPS-1797 |
| experimental_design | PCR adapter sequence AAGCAGTGGTATCAACGCAGAGTACT |
| facility | BRF |
| facility_sample_id | 927-3 |
| family | Meloidogynidae |
| flowcell_id | m84118_250606_030322_s1 |
| flowcell_type | SMRT Cell 25M |
| folder_name | 20250606_PP_BRF_m84118_250606_030322_s1 |
| genus | Meloidogyne |
| host_common_name | Tomato |
| host_family | Solanaceae |
| host_organ | Root |
| host_scientific_name | Solanum lycopersicum |
| host_status | Research culture |
| host_symptom | Galling |
| insert_size_range | 9998.0 |
| library_construction_protocol | PacBio ultra low input |
| library_id | 398415 |
| library_index_id_dual | bc2039 |
| library_index_seq_dual | CATGTATGTCGAGTAT |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 52.6 |
| library_pcr_cycles | 10 |
| library_pcr_reps | 1 |
| library_prep_date | 2025-06-05 |
| library_prepared_by | Xiangning Liu |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGA |
| library_type | PacBio-HiFi |
| life_stage | Adult |
| location_text | Ecosciences Precinct, Brisbane, Queensland Department of Agriculture and Fisheries |
| material_extracted_by | Avalon Yennefer | CISRO |
| material_extraction_date | 2024-11-26 |
| material_extraction_method | Qiagen tip 20/G kit |
| material_extraction_type | gDNA |
| metadata_revision_date | 2025-11-19 |
| metadata_revision_filename | 2025-11-14_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
| movie_length | 30h |
| n_libraries_pooled | 4.0 |
| order | Rhabditida |
| phylum | Nematoda |
| project_lead | Daniel Huston | CSIRO |
| sample_collection_type | Ethanol |
| sample_custodian | Daniel Huston | CSIRO, ANIC |
| sample_id | 396014 |
| sample_type | Infested roots |
| scientific_name | Meloidogyne javanica |
| scientific_name_authorship | (Treub, 1885) Chitwood, 1949 |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | SPRQ |
| sequencing_model | PacBio Revio |
| sequencing_platform | PacBio |
| species | javanica |
| specimen_custodian | CSIRO Australian National Insect Collection (ANIC); Nematology Section (Nema) |
| specimen_id | ANIC NEMA eth 19871 |
| specimen_id_description | Australian National Insect Collection; Nematology ethanol collection |
| state_or_region | Queensland |
| taxon_id | 6303 |
| taxonomic_group | Nematode |
| ticket | BPAOPS-1797 |