Plant Pathogen, Transcriptomics, PromethION, Sample ID 396173

Ascochyta lentis, Lars Kamphuis | Curtin University

Dataset size is: 0.00 b

Log in or Register to access resource
 
 

 

Data and Resources

Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj056
Access Control Date 2026-10-24
Access Control Mode date
Sequence Data Type ont-promethion
analysis_software MinKNOW 25.35.14
base_url https://downloads-qcif.bioplatforms.com/bpa/pp_staging/ont-promethion/BPAOPS-1932/20251001_PP_BRF_PBE55104/
bioplatforms_dataset_id 102.100.100/399080
bioplatforms_library_id 102.100.100/398584
bioplatforms_project Plant Pathogen Initiative
bioplatforms_project_code PP056_A_lentis
bioplatforms_sample_id 102.100.100/396173
ccg_jira_ticket BPAOPS-1932
cell_postion 3C
class Dothideomycete
collector Thangam, Nimllash
collector_sample_id AlKewell_in_planta
common_name Ascochyta blight
coord_uncertainty_metres ND
country Australia
data_context Transcriptomics
data_type ONT
date_data_published 06/11/2025
date_of_transfer 2025-10-24
date_of_transfer_to_archive 2025-11-03
decimal_latitude_public ND
decimal_longitude_public ND
description PromethION (RNA)
download https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket:BPAOPS-1932
experimental_design ONT RNA-cDNA
facility BRF
facility_project_code ONT_RNA17_1026
facility_sample_id 1026-4
family Didymellaceae
fast5_compression pod5 bvz
flowcell_id PBE55104
flowcell_type FLO-PRO114M
folder_name 20251001_PP_BRF_PBE55104
genus Ascochyta
host_common_name Lentil
host_family Fabaceae
host_organ Foliage
host_scientific_name Lens culinaris
host_status Cultivated
host_symptom Blight
insert_size_range 1200.0
isolate AlKewell
library_construction_protocol cDNA-PCR barcoded libraries with SQK-PCB114.2
library_id 398584
library_index_id BP04
library_index_seq TTCGGATTCTATCGTGTTTCCCTA
library_layout NA
library_location BRF labs
library_ng_ul 4.52
library_pcr_cycles 14.0
library_pcr_reps 2.0
library_prep_date 2025-10-02
library_prepared_by Xiangning Liu
library_selection random
library_source total RNA
library_type ONT-PromethION
life_stage Infected leaf tissue
location_info_restricted No
location_text Bentley
material_conc_ng_ul 500.0
material_extracted_by Nimllash Thangam
material_extraction_method Trizol RNA extraction
material_extraction_type RNA
metadata_revision_date 2025-11-19
metadata_revision_filename 2025-11-14_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx
model_base_caller Super-accurate – v5.0.0 – 400bps
n_libraries_pooled 4.0
order Pleosporales
phylum Ascomycota
project_lead Lars Kamphuis | Curtin University
sample_collection_type Culture collection
sample_custodian Centre for Crop and Disease Management (CCDM), Curtin University
sample_id 396173
sample_type Single spored inoculated on lentil
scientific_name Ascochyta lentis
scientific_name_authorship Kaiser et al (1997)
scientific_name_note Alternate name: Ascochyta fabae f.sp. lentis
sequencing_facility Biomolecular Resource Facility
sequencing_kit_chemistry_version SQK-PCB114..24
sequencing_model ONT PromethION
sequencing_platform Oxford Nanopore
species lentis
specimen_custodian Grains Research and Development Corporation (GRDC), Curtin University
specimen_id AlKewell_in_planta
specimen_id_description Centre for Crop and Disease Management (CCDM) Pulse Pathology Culture Collection
state_or_region WA
taxon_id 205686
taxonomic_group Fungi
ticket BPAOPS-1932
tissue Infected leaf tissue
tissue_preservation Snap frozen in liquid nitrogen
tissue_preservation_temperature -70°C
work_order 20069.0