Plant Pathogen, Transcriptomics, PromethION, Sample ID 396173
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until October 24, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
396173_LibID398584_PP_BRF_PBE551... Metadata Only TAR
-
396173_LibID398584_PP_BRF_PBE551... Metadata Only TAR
-
PP_BRF_PBE55104_ONTPromethION_ba... Metadata Only
-
396173_LibID398584_PP_BRF_PBE551... Metadata Only TAR
-
PP_BRF_PBE55104_ONTPromethION_re... Metadata Only HTML
-
PP_BRF_PBE55104_ONTPromethION_se... Metadata Only
-
396173_LibID398584_PP_BRF_PBE551... Metadata Only TAR
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj056 |
| Access Control Date | 2026-10-24 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| analysis_software | MinKNOW 25.35.14 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/ont-promethion/BPAOPS-1932/20251001_PP_BRF_PBE55104/ |
| bioplatforms_dataset_id | 102.100.100/399080 |
| bioplatforms_library_id | 102.100.100/398584 |
| bioplatforms_project | Plant Pathogen Initiative |
| bioplatforms_project_code | PP056_A_lentis |
| bioplatforms_sample_id | 102.100.100/396173 |
| ccg_jira_ticket | BPAOPS-1932 |
| cell_postion | 3C |
| class | Dothideomycete |
| collector | Thangam, Nimllash |
| collector_sample_id | AlKewell_in_planta |
| common_name | Ascochyta blight |
| coord_uncertainty_metres | ND |
| country | Australia |
| data_context | Transcriptomics |
| data_type | ONT |
| date_data_published | 06/11/2025 |
| date_of_transfer | 2025-10-24 |
| date_of_transfer_to_archive | 2025-11-03 |
| decimal_latitude_public | ND |
| decimal_longitude_public | ND |
| description | PromethION (RNA) |
| download | https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket:BPAOPS-1932 |
| experimental_design | ONT RNA-cDNA |
| facility | BRF |
| facility_project_code | ONT_RNA17_1026 |
| facility_sample_id | 1026-4 |
| family | Didymellaceae |
| fast5_compression | pod5 bvz |
| flowcell_id | PBE55104 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20251001_PP_BRF_PBE55104 |
| genus | Ascochyta |
| host_common_name | Lentil |
| host_family | Fabaceae |
| host_organ | Foliage |
| host_scientific_name | Lens culinaris |
| host_status | Cultivated |
| host_symptom | Blight |
| insert_size_range | 1200.0 |
| isolate | AlKewell |
| library_construction_protocol | cDNA-PCR barcoded libraries with SQK-PCB114.2 |
| library_id | 398584 |
| library_index_id | BP04 |
| library_index_seq | TTCGGATTCTATCGTGTTTCCCTA |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 4.52 |
| library_pcr_cycles | 14.0 |
| library_pcr_reps | 2.0 |
| library_prep_date | 2025-10-02 |
| library_prepared_by | Xiangning Liu |
| library_selection | random |
| library_source | total RNA |
| library_type | ONT-PromethION |
| life_stage | Infected leaf tissue |
| location_info_restricted | No |
| location_text | Bentley |
| material_conc_ng_ul | 500.0 |
| material_extracted_by | Nimllash Thangam |
| material_extraction_method | Trizol RNA extraction |
| material_extraction_type | RNA |
| metadata_revision_date | 2025-11-19 |
| metadata_revision_filename | 2025-11-14_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
| model_base_caller | Super-accurate – v5.0.0 – 400bps |
| n_libraries_pooled | 4.0 |
| order | Pleosporales |
| phylum | Ascomycota |
| project_lead | Lars Kamphuis | Curtin University |
| sample_collection_type | Culture collection |
| sample_custodian | Centre for Crop and Disease Management (CCDM), Curtin University |
| sample_id | 396173 |
| sample_type | Single spored inoculated on lentil |
| scientific_name | Ascochyta lentis |
| scientific_name_authorship | Kaiser et al (1997) |
| scientific_name_note | Alternate name: Ascochyta fabae f.sp. lentis |
| sequencing_facility | Biomolecular Resource Facility |
| sequencing_kit_chemistry_version | SQK-PCB114..24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| species | lentis |
| specimen_custodian | Grains Research and Development Corporation (GRDC), Curtin University |
| specimen_id | AlKewell_in_planta |
| specimen_id_description | Centre for Crop and Disease Management (CCDM) Pulse Pathology Culture Collection |
| state_or_region | WA |
| taxon_id | 205686 |
| taxonomic_group | Fungi |
| ticket | BPAOPS-1932 |
| tissue | Infected leaf tissue |
| tissue_preservation | Snap frozen in liquid nitrogen |
| tissue_preservation_temperature | -70°C |
| work_order | 20069.0 |