Plant Pathogen, Genomics, PromethION, Sample ID 396151
Dataset size is: 0.00 b
This dataset is currently under a short embargo period until October 27, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
PP_BRF_PBE84070_ONTPromethION_re... Metadata Only HTML
-
396151_LibID398562_PP_BRF_PBE840... Metadata Only TAR
-
PP_BRF_PBE84070_ONTPromethION_ba... Metadata Only
-
396151_LibID398562_PP_BRF_PBE840... Metadata Only TAR
-
396151_LibID398562_PP_BRF_PBE840... Metadata Only TAR
-
396151_LibID398562_PP_BRF_PBE840... Metadata Only TAR
-
PP_BRF_PBE84070_ONTPromethION_se... Metadata Only
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj056 |
| Access Control Date | 2026-10-27 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| analysis_software | MinKNOW 25.05.14 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/ont-promethion/BPAOPS-1937/20251014_PP_BRF_PBE84070/ |
| bioplatforms_dataset_id | 102.100.100/399095 |
| bioplatforms_library_id | 102.100.100/398562 |
| bioplatforms_project | Plant Pathogen Initiative |
| bioplatforms_project_code | PP056_A_lentis |
| bioplatforms_sample_id | 102.100.100/396151 |
| ccg_jira_ticket | BPAOPS-1937 |
| cell_postion | 2F |
| class | Dothideomycete |
| collector | Washington State University |
| collector_sample_id | Al-156 |
| common_name | Ascochyta blight |
| country | Syria |
| data_context | Genomics |
| data_type | ONT |
| date_data_published | 06/11/2025 |
| date_of_transfer | 2025-10-27 |
| date_of_transfer_to_archive | 2025-11-04 |
| description | PromethION |
| download | https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket:BPAOPS-1937 |
| experimental_design | ONT long reads |
| facility | BRF |
| facility_project_code | ONT_gDNA185_1025 |
| facility_sample_id | 1025-82 |
| family | Didymellaceae |
| fast5_compression | pod5 vbz |
| flowcell_id | PBE84070 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20251014_PP_BRF_PBE84070 |
| genus | Ascochyta |
| host_common_name | Lentil |
| host_family | Fabaceae |
| host_organ | Foliage |
| host_scientific_name | Lens culinaris |
| host_status | Cultivated |
| host_symptom | Blight |
| insert_size_range | 7.7 kb |
| isolate | AlSYR0009 |
| library_construction_protocol | Native barcoded ligation libraries with SQK-NBD114.96 |
| library_id | 398562 |
| library_index_id | barcode72 |
| library_index_seq | TAGCTGACTGTCTTCCATACCGAC |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 143.0 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-10-14 |
| library_prepared_by | Ziyan Zhang |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ONT-PromethION |
| life_stage | Fungal mycelium |
| location_text | Aleppo |
| material_conc_ng_ul | 77.0 |
| material_extracted_by | Centre for Crop and Disease Management (CCDM) Curtin University |
| material_extraction_date | 2025-06-30 |
| material_extraction_method | https://www.protocols.io/view/phenol-chloroform-genomic-dna-extraction-from-tiss-4r3l28mq4l1y/v1 |
| material_extraction_type | gDNA |
| metadata_revision_date | 2025-11-19 |
| metadata_revision_filename | 2025-11-14_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
| model_base_caller | Super-accurate – v5.0.0 – 400bps |
| movie_length | 5d 6h |
| n_libraries_pooled | 25.0 |
| order | Pleosporales |
| phylum | Ascomycota |
| project_lead | Lars Kamphuis | Curtin University |
| sample_collection_type | Culture collection |
| sample_custodian | Centre for Crop and Disease Management (CCDM), Curtin University |
| sample_id | 396151 |
| sample_type | Single spored isolate |
| scientific_name | Ascochyta lentis |
| scientific_name_authorship | Kaiser et al (1997) |
| scientific_name_note | Alternate name: Ascochyta fabae f.sp. lentis |
| sequencing_facility | Biomolecular Resource Facility |
| sequencing_kit_chemistry_version | SQK-NBD114.96 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| species | lentis |
| specimen_custodian | Grains Research and Development Corporation (GRDC), Curtin University |
| specimen_id | AlSYR0009 |
| specimen_id_description | Centre for Crop and Disease Management (CCDM) Pulse Pathology Culture Collection |
| state_or_region | NA |
| taxon_id | 205686 |
| taxonomic_group | Fungi |
| ticket | BPAOPS-1937 |
| work_order | 20068.0 |