Plant Pathogen, Genomics, PromethION, Sample ID 396135

Ascochyta lentis, Lars Kamphuis | Curtin University

Dataset size is: 0.00 b

Log in or Register to access resource
 
 

 

Data and Resources

Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj056
Access Control Date 2026-10-27
Access Control Mode date
Sequence Data Type ont-promethion
analysis_software MinKNOW 25.05.14
base_url https://downloads-qcif.bioplatforms.com/bpa/pp_staging/ont-promethion/BPAOPS-1936/20251014_PP_BRF_PBE82877/
bioplatforms_dataset_id 102.100.100/399094
bioplatforms_library_id 102.100.100/398546
bioplatforms_project Plant Pathogen Initiative
bioplatforms_project_code PP056_A_lentis
bioplatforms_sample_id 102.100.100/396135
ccg_jira_ticket BPAOPS-1936
cell_postion 2B
class Dothideomycete
collector Washington State University
collector_sample_id Al-19
common_name Ascochyta blight
country Spain
data_context Genomics
data_type ONT
date_data_published 06/11/2025
date_of_transfer 2025-10-27
date_of_transfer_to_archive 2025-11-04
description PromethION
download https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket:BPAOPS-1936
experimental_design ONT long reads
facility BRF
facility_project_code ONT_gDNA185_1025
facility_sample_id 1025-66
family Didymellaceae
fast5_compression pod5 vbz
flowcell_id PBE82877
flowcell_type FLO-PRO114M
folder_name 20251014_PP_BRF_PBE82877
genus Ascochyta
host_common_name Lentil
host_family Fabaceae
host_organ Foliage
host_scientific_name Lens culinaris
host_status Cultivated
host_symptom Blight
insert_size_range 5.2 kb
isolate AlESP0002
library_construction_protocol Native barcoded ligation libraries with SQK-NBD114.96
library_id 398546
library_index_id barcode56
library_index_seq TCACTACTCAACAGGTGGCATGAA
library_layout NA
library_location BRF labs
library_ng_ul 144.0
library_oligo_sequence 5' - AAGGTTAA - barcode - CAGCACCT - 3'
library_prep_date 2025-10-14
library_prepared_by Ziyan Zhang
library_selection random
library_source genomic
library_strategy WGS
library_type ONT-PromethION
life_stage Fungal mycelium
location_text ND
material_conc_ng_ul 149.0
material_extracted_by Centre for Crop and Disease Management (CCDM) Curtin University
material_extraction_date 2025-06-30
material_extraction_method https://www.protocols.io/view/phenol-chloroform-genomic-dna-extraction-from-tiss-4r3l28mq4l1y/v1
material_extraction_type gDNA
metadata_revision_date 2025-11-19
metadata_revision_filename 2025-11-14_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx
model_base_caller Super-accurate – v5.0.0 – 400bps
movie_length 5d 6h
n_libraries_pooled 25.0
order Pleosporales
phylum Ascomycota
project_lead Lars Kamphuis | Curtin University
sample_collection_type Culture collection
sample_custodian Centre for Crop and Disease Management (CCDM), Curtin University
sample_id 396135
sample_type Single spored isolate
scientific_name Ascochyta lentis
scientific_name_authorship Kaiser et al (1997)
scientific_name_note Alternate name: Ascochyta fabae f.sp. lentis
sequencing_facility Biomolecular Resource Facility
sequencing_kit_chemistry_version SQK-NBD114.96
sequencing_model ONT PromethION
sequencing_platform Oxford Nanopore
species lentis
specimen_custodian Grains Research and Development Corporation (GRDC), Curtin University
specimen_id AlESP0002
specimen_id_description Centre for Crop and Disease Management (CCDM) Pulse Pathology Culture Collection
state_or_region NA
taxon_id 205686
taxonomic_group Fungi
ticket BPAOPS-1936
work_order 20068.0