Plant Pathogen, Genomics, PromethION, Sample ID 395613

Puccinia striiformis f. sp. tritici, Benjamin Schwessinger / Mareike Moeller | Australian National University

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj044
Access Control Date 2024-10-31
Access Control Mode date
Sequence Data Type ont-promethion
analysis_software MinKNOW 23.07.12
associated_media https://journals.asm.org/doi/10.1128/mbio.01650-17
base_url https://downloads-qcif.bioplatforms.com/bpa/pp_staging/ont-promethion/BPAOPS-1508/20231023_PP_BRF_PAQ10940/
bioplatforms_dataset_id 102.100.100/399044
bioplatforms_library_id 102.100.100/397867
bioplatforms_project Plant Pathogen Initiative
bioplatforms_project_code PP044_Puccinia_2
bioplatforms_sample_id 102.100.100/395613
ccg_jira_ticket BPAOPS-1508
cell_postion 2H
class Pucciniomycetes
collection_date 1982-01-01
collection_method Field isolate, singule postule isolation
collection_permit NA
collector Colin Wellings
collector_sample_id Plant Breeding Institute accession number 821559 =415
common_name Stripe rust fungus
country Australia
data_context Genomics
data_type ONT
date_data_published 06/11/2023
date_of_transfer 2023-11-01
date_of_transfer_to_archive 2023-11-02
description PromethION
dna_treatment unknown -prepared by client
download https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1508
facility BRF
facility_sample_id ONT_Lib1_555_3
family Pucciniaceae
fast5_compression vbz
flowcell_id PAQ10940
flowcell_type FLO-PRO114M
folder_name 20231023_PP_BRF_PAQ10940 (sample ID 395613 - 395624)
genus Puccinia
host_common_name Bread wheat
host_family Poaceae
host_organ Leaf
host_scientific_name Triticum aestivum
host_status Cereal crop
host_symptom Fungal spores on leaves
insert_size_range 1400.0
isolate Pst104E
library_comments Library prepared by client
library_construction_protocol SQK-NBD114.96
library_id 397867
library_index_id barcode45
library_index_id_dual NA
library_index_seq GATCCAACAGAGATGCCTTCAGTG
library_index_seq_dual NA
library_layout NA
library_location BRF labs
library_ng_ul 9.92
library_oligo_sequence 5' - AAGGTTAA - barcode - CAGCACCT - 3'
library_oligo_sequence_dual NA
library_pcr_cycles unknown -prepared by client
library_pcr_reps unknown -prepared by client
library_prepared_by unknown -prepared by client
library_selection unknown -prepared by client
library_source unknown -prepared by client
library_strategy cDNA ligated with Nanopore native adapters
library_type cDNA
location_text Wheat field in NSW
material_conc_ng_ul 1040.0
material_extracted_by Mareike Moeller | ANU
material_extraction_date 2023-09-14
material_extraction_method Trizol
material_extraction_type RNA
metadata_revision_date 2025-11-19
metadata_revision_filename 2025-11-14_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx
model_base_caller Super-accurate basecalling, 400 bps
movie_length NA
n_libraries_pooled 12.0
order Pucciniales
phylum Basidiomycota
project_lead Benjamin Schwessinger / Mareike Moeller | Australian National University
sample_collection_type University, greenhouse experiment
sample_custodian Benjamin Schwessinger | ANU
sample_id 395613
sample_type Wheat leaf infected with stripe rust
scientific_name Puccinia striiformis f. sp. tritici
sequencing_facility Biomolecular Resource Facility
sequencing_kit_chemistry_version SQK-NBD114.96
sequencing_model PromethION24
sequencing_platform Oxford Nanopore
species Puccinia striiformis
specimen_custodian Benjamin Schwessinger | ANU
specimen_id Pst104E
specimen_id_description Puccinia striiformis f. sp. tritici (Pst), pathotype 104E
state_or_region NSW
sub_species Puccinia striiformis f. sp. tritici
taxon_id 168172
taxonomic_group Fungi
ticket BPAOPS-1508
tissue Infected leaf, 10 dpi, replicate 1
tissue_preservation Snap frozen
tissue_preservation_temperature -80C