Ghost bat, unknown, genome short read, liver | heart | kidney
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:archive_ingestion_date:365:omg-consortium-members |
| Access Control Date | 2020-03-19 |
| Access Control Mode | date |
| Sequence Data Type | illumina-shortread |
| access_rights | location information restricted |
| ala_specimen_url | NA |
| ancillary_notes | Different DNA extracts used for genome and exon capture |
| archive_ingestion_date | 2019-03-25 |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/omg_staging/genomics-novaseq/BPAOPS-815/ |
| birth_date | unknown |
| bpa_dataset_id | 102.100.100/52606 |
| bpa_library_id | 102.100.100/53911 |
| bpa_sample_id | 102.100.100/41193 |
| bpa_work_order | 40026 |
| class | Mammalia |
| collection_date | 2015-01-08 |
| collection_method | unknown |
| collector | unknown |
| collector_sample_id | NA |
| common_name | Ghost bat |
| coord_uncertainty_metres | NA |
| country | Australia |
| custodian | Kyle Armstrong |
| data_custodian | Kym Ottewell | Kyle Armstrong |
| data_generated | 2019-03-25 |
| data_type | Illumina FASTQ |
| dataset_url | (ingested) |
| date_of_transfer | 2019-03-20 |
| ddrad_data | no |
| ddrad_dataset_ids | NA |
| death_date | unknown |
| description | NovaSeq 6000- Whole Genome - 41193 and 41194 |
| dna_conc_ng_ul | unknown |
| dna_extracted_by | Kyle Armstrong |
| dna_extraction_date | 2018-11-29 |
| dna_extraction_method | unknown |
| dna_treatment | NA |
| exon_capture_data | no |
| exon_capture_dataset_ids | NA |
| experimental_design | replicate DNA extractions for sample 41193 pooled for library prep, 50 Gb/sample (NovaSeq 6000 S4, 300 cycles) |
| facility_sample_id | 8893_01 |
| family | Megadermatidae |
| file | 53911_ABTC50957_pool_HG2W3DSXX_CCAAGTCT-AAGGATGA_L001_R1.fastq.gz | 53911_ABTC50957_pool_HG2W3DSXX_CCAAGTCT-AAGGATGA_L001_R2.fastq.gz |
| flowcell_id | HG2W3DSXX |
| folder_name | 20190313_AGRF_BPA_OMG_HG2W3DSXX |
| genome_data | yes |
| genome_dataset_ids | 52606 | 52608 |
| genus | Macroderma |
| habitat | unknown |
| identified_by | unknown |
| institution_name | Australian Biological Tissue Collection, South Australian Museum |
| library_comments | libraries prepared from pooled replicated DNA extractions |
| library_index_id | UDI0013 |
| library_index_sequence | CCAAGTCT-AAGGATGA |
| library_location | AGRF |
| library_ng_ul | 40.4 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGACTTGGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACAAGGATGAACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| library_pcr_cycles | 8.0 |
| library_prep_date | 2018-12-17 |
| library_prep_method | TruSeq DNA Nano |
| library_prepared_by | Amy Longva |
| library_status | Sequencing completed |
| library_type | genome short read |
| life_stage | not determined |
| location_text | 1km S Pine Creek |
| n_libraries_pooled | 1 |
| omg_project | unknown |
| order | Chiroptera |
| phylum | Chordata |
| prior_genetics | unknown |
| sample_quality | high quality |
| sample_submission_date | 2019-03-20 |
| sequence_length | 150 bp PE |
| sequencing_facility | AGRF |
| sequencing_platform | NovaSeq 6000 |
| sex | male |
| software_version | bcl2fastq pipeline version 2.20.0.422 |
| source_population | unknown |
| species | gigas |
| state_or_region | Northern Territory |
| subspecies_or_variant | NA |
| taxon_id | 9411 |
| taxonomic_group | bat |
| ticket | BPAOPS-815 |
| tissue_collection | Mammal |
| tissue_number | ABTC50957 |
| tissue_preservation | frozen -80C |
| tissue_type | liver | heart | kidney |
| trace_lab | no |
| type_status | unknown |
| voucher_id | ABTC50957 |
| voucher_number | no voucher |
| voucher_or_tissue_number | ABTC50957 |
| wild_captive | unknown |