Grasslands PacBio-IsoSeq, Reference genomes, Sample ID 369700
Dataset size is: 0.00 b
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:grassland-consortium-members |
| Access Control Date | 2025-06-26 |
| Access Control Mode | date |
| Sequence Data Type | pacbio-hifi |
| analysis_software | SMRT Link Analysis 13.0.0.208615 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/grasslands/pacbio-hifi/BPAOPS-1603/20240620_AG_AGRF_CAGRF24020350_m84073_240615_195929_s4/ |
| bioplatforms_project | Australian Grasslands Initiative (AG) |
| cell_postion | A01 |
| common_name | Kangaroo grass |
| data_context | Transcriptomics - long read |
| data_type | Main dataset |
| dataset_id | 102.100.100/373573 |
| dataset_url | https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1603 |
| date_data_published | 28/06/2024 |
| date_of_transfer | 2024-06-26 |
| date_of_transfer_to_archive | 2024-06-27 |
| description | PacBio-IsoSeq |
| dna_treatment | NA |
| experimental_design | NA |
| experimental_notes | RNA tissue - florets |
| facility | AGRF |
| facility_sample_id | 371792.0 |
| family | Poaceae |
| fast5_compression | NA |
| flowcell_id | m84073_240615_195929_s4 |
| flowcell_type | SMRT Cell 25M |
| folder_name | 20240620_AG_AGRF_CAGRF24020350_m84073_240615_195929_s4 |
| growth_facility | Macquarie University Plant Growth facility |
| initiative_prefix | Grasslands |
| insert_size_range | NA |
| library_comments | NA |
| library_construction_protocol | Preparing Kinnex libraries using the Kinnex full-length RNA kit |
| library_id | 102.100.100/371792 |
| library_index_id | IsoSeqX_bc12_5p |
| library_index_id_dual | NA |
| library_index_seq | CTACACGACGCTCTTCCGATCTGTATGACGCAATGAAGTCGCAGGGTTGGG |
| library_index_seq_dual | NA |
| library_layout | NA |
| library_location | AGRF |
| library_ng_ul | 3.1 |
| library_oligo_sequence | NA |
| library_oligo_sequence_dual | NA |
| library_pcr_cycles | 10 |
| library_pcr_reps | 1 |
| library_prep_date | 2024-06-02 |
| library_prepared_by | Trent Peters |
| library_selection | NA |
| library_source | RNA |
| library_strategy | RNAseq |
| library_type | PacBio-IsoSeq |
| metadata_revision_date | 2024-12-16 |
| metadata_revision_filename | Australian_grasslands_metadata_combined_2024-12-12_forQCIF.xlsx |
| model_base_caller | NA |
| movie_length | 30Hrs |
| n_libraries_pooled | 6 |
| plant_growth_medium | Standard MQ loam |
| ploidy | 2n |
| preservation_date_begin | 2024-04-24 |
| preservation_storage_location | Western Sydney University |
| preservation_temperature | -80°C |
| project_aim | Reference genomes |
| sample_id | 102.100.100/369700 |
| sample_material_associated_references | Bioline-BIO-52073 |
| sample_material_preparation_date | 2024-04-24 |
| sample_material_preparation_process | BIO-52073 RNA extraction kit |
| sample_material_preparation_type | RNA |
| sample_material_prepared_by | Brian Atwell | Vinod Jacob | Lily Chen | Western Sydney University |
| sample_replicate | NA |
| scientific_name | Themeda triandra |
| scientific_name_authorship | Forssk |
| sequencing_facility | AGRF |
| sequencing_kit_chemistry_version | Revio sequencing plate |
| sequencing_model | PacBio Revio |
| sequencing_platform | PACBIO_SMRT |
| taxon_id | 106636 |
| team_lead_email | brian.atwell@mq.edu.au |
| team_lead_name | Brian Atwell |
| ticket | BPAOPS-1603 |