Grasslands PacBio-IsoSeq, Reference genomes, Sample ID 369564

Kangaroo grass, Themeda triandra, Poaceae, Location ID Narara, Brian Atwell

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:grassland-consortium-members
Access Control Date 2025-06-26
Access Control Mode date
Sequence Data Type pacbio-hifi
analysis_software SMRT Link Analysis 13.0.0.208615
base_url https://downloads-qcif.bioplatforms.com/bpa/grasslands/pacbio-hifi/BPAOPS-1603/20240620_AG_AGRF_CAGRF24020350_m84073_240615_195929_s4/
bioplatforms_project Australian Grasslands Initiative (AG)
cell_postion A01
collected_by Rachael Gallagher
collection_date 2021-06-16
common_name Kangaroo grass
country Australia
data_context Transcriptomics - long read
data_type Main dataset
dataset_id 102.100.100/373573
dataset_url https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1603
date_data_published 28/06/2024
date_of_transfer 2024-06-26
date_of_transfer_to_archive 2024-06-27
decimal_latitude_public -33.39
decimal_longitude_public 151.33
description PacBio-IsoSeq
dna_treatment NA
experimental_design NA
experimental_notes RNA tissue - root tips
facility AGRF
facility_sample_id 371789.0
family Poaceae
fast5_compression NA
flowcell_id m84073_240615_195929_s4
flowcell_type SMRT Cell 25M
folder_name 20240620_AG_AGRF_CAGRF24020350_m84073_240615_195929_s4
growth_facility Macquarie University Plant Growth facility
id_vetting_by Karen
initiative_prefix Grasslands
insert_size_range NA
latitude -33.39
library_comments NA
library_construction_protocol Preparing Kinnex libraries using the Kinnex full-length RNA kit
library_id 102.100.100/371789
library_index_id IsoSeqX_bc08_5p
library_index_id_dual NA
library_index_seq CTACACGACGCTCTTCCGATCTCGTATGTGCAATGAAGTCGCAGGGTTGGG
library_index_seq_dual NA
library_layout NA
library_location AGRF
library_ng_ul 3.8
library_oligo_sequence NA
library_oligo_sequence_dual NA
library_pcr_cycles 10
library_pcr_reps 1
library_prep_date 2024-06-02
library_prepared_by Trent Peters
library_selection NA
library_source RNA
library_strategy RNAseq
library_type PacBio-IsoSeq
location_id Narara
longitude 151.33
metadata_revision_date 2024-12-16
metadata_revision_filename Australian_grasslands_metadata_combined_2024-12-12_forQCIF.xlsx
model_base_caller NA
movie_length 30Hrs
n_libraries_pooled 6
plant_growth_medium Standard MQ loam
ploidy 2n
preservation_date_begin 2024-04-24
preservation_storage_location Western Sydney University
preservation_temperature -80°C
project_aim Reference genomes
sample_id 102.100.100/369564
sample_material_associated_references Bioline-BIO-52073
sample_material_preparation_date 2024-04-24
sample_material_preparation_process BIO-52073 RNA extraction kit
sample_material_preparation_type RNA
sample_material_prepared_by Brian Atwell | Vinod Jacob | Lily Chen | Western Sydney University
sample_replicate NA
scientific_name Themeda triandra
scientific_name_authorship Forssk
sequencing_facility AGRF
sequencing_kit_chemistry_version Revio sequencing plate
sequencing_model PacBio Revio
sequencing_platform PACBIO_SMRT
state_or_territory NSW
taxon_id 106636
team_lead_email brian.atwell@mq.edu.au
team_lead_name Brian Atwell
ticket BPAOPS-1603