Grasslands Hi-C, Reference genomes, Sample ID 369564
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:grassland-consortium-members |
| Access Control Date | 2025-12-31 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| Related Data | Hi-C |
| analysis_software | Bcl2Fastq |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/grasslands/genomics-hi-c/BPAOPS-1514/20231109_AG_BRF_HMMYTDRX3/ |
| bioplatforms_project | Australian Grasslands Initiative (AG) |
| ccg_jira_ticket | BPAOPS-1514 |
| collected_by | Rachael Gallagher |
| collection_date | 2021-06-16 |
| common_name | Kangaroo grass |
| country | Australia |
| data_context | Reference genome |
| data_type | Main dataset |
| dataset_id | 373565 |
| date_data_published | 04/01/2024 |
| date_of_transfer | 2023-11-10 |
| date_of_transfer_to_archive | 2023-11-14 |
| decimal_latitude_public | -33.39 |
| decimal_longitude_public | 151.33 |
| description | Hi-C |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| download | https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1514 |
| experimental_design | Arima HiC 2.0 single index |
| facility | BRF |
| facility_sample_id | 369564_LibID371565_AG_BRF_HMMYTDRX3_TCAGCATC |
| family | Poaceae |
| fast5_compression | .gz |
| flowcell_id | HMMYTDRX3 |
| flowcell_type | NovaSeq 6000 SP |
| folder_name | 20231109_AG_BRF_HMMYTDRX3 |
| growth_facility | Macquarie University Plant Growth facility |
| id_vetting_by | Karen |
| initiative_prefix | Grasslands |
| insert_size_range | ~1000bp |
| latitude | -33.39 |
| library_comments | Concentration and size was assesd by TapeStation and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 371565 |
| library_index_id | Index_5 |
| library_index_seq | TCAGCATC |
| library_layout | paired-end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.6 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCAGCATC (AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 6 |
| library_pcr_reps | 1 |
| library_prep_date | 2023-11-02 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | Illumina-HiC |
| location_id | Narara |
| longitude | 151.33 |
| metadata_revision_date | 2024-12-16 |
| metadata_revision_filename | Australian_grasslands_metadata_combined_2024-12-12_forQCIF.xlsx |
| n_libraries_pooled | 1 |
| plant_developmental_stage | Floret emergence |
| plant_growth_medium | Standard MQ loam |
| ploidy | 2n |
| project_aim | Reference genomes |
| sample_id | 102.100.100/369564 |
| sample_replicate | NA |
| sample_submitter_name | Ashley Jones |
| scientific_name | Themeda triandra |
| scientific_name_authorship | Forssk |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | NovaSeq v1.5 |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | Illumina |
| state_or_territory | NSW |
| taxon_id | 106636 |
| team_lead_email | brian.atwell@mq.edu.au |
| team_lead_name | Brian Atwell |
| ticket | BPAOPS-1514 |
| work_order | WO16004 |