Grasslands Illumina ddRAD-seq, Genotyping, Dataset ID 373572

Kangaroo grass, Themeda triandra, Poaceae, Location ID Sydney, Brian Atwell

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:grassland-consortium-members
Access Control Date 2025-10-28
Access Control Mode date
Sequence Data Type illumina-ddrad
accession_number_seed ?
base_url https://downloads-qcif.bioplatforms.com/bpa/grasslands/ddrad/BPAOPS-1711/20241023_AG_AGRF_22NTCKLT3/
bioplatforms_dataset_id 102.100.100/373572
bioplatforms_project Australian Grasslands Initiative (AG)
bpa_dataset_id 102.100.100/373572
collected_by Brian Atwell
common_name Kangaroo grass
country Australia
data_context Genomics - genotyping
data_type ddRAD
dataset_url https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1711
date_of_transfer 2024-10-28
date_of_transfer_to_archive 2024-10-29
decimal_latitude_public -33.68810173
decimal_longitude_public 151.0624105
description Illumina ddRAD-seq
experimental_design PstI/HpyCH4IV
experimental_notes Replicate-j
facility_project_code CAGRF23120086-1
family Poaceae
flowcell_id 22NTCKLT3
flowcell_type 10B
folder_name 20241023_AG_AGRF_22NTCKLT3
growth_condition Low_Temperature
growth_facility Macquarie University Glasshouses
insert_size_range 280-375 bp
latitude -33.68810173
library_construction_protocol ddRAD (based on Peterson et al 2012)
library_layout paired end
library_location AGRF_Perth
library_oligo_sequence AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G
library_pcr_cycles 11.0
library_pcr_reps 7.0
library_prep_date 2024-10-07
library_prepared_by Jeremy Beerkens
library_selection Restriction Digest
library_source GENOMIC
library_strategy RAD-Seq
library_type ddRAD
location_id Sydney
longitude 151.0624105
metadata_revision_date 2024-12-16
metadata_revision_filename Australian_grasslands_metadata_combined_2024-12-12_forQCIF.xlsx
n_libraries_pooled 3.0
plant_developmental_stage Vegetative
plant_growth_medium Soil & Potting Mix
plant_structure Tussock Grass
preservation_date_begin 2023-12-12
preservation_storage_location University of Tasmania
preservation_temperature -80°C
preservation_type Stored in nuclease free water
project_aim Genotyping
sample_id 102.100.100/369658
sample_material_preparation_date 2023-12-12
sample_material_preparation_process CTAB extraction with RNAse treatment
sample_material_preparation_type DNA
sample_material_prepared_by Jazmine Humphreys | Vinod Jacob | Alejandro Correa Lozano | University of Tasmania
sample_replicate 4.0
scientific_name Themeda triandra
scientific_name_authorship Forssk
sequencing_facility AGRF_Melbourne
sequencing_model NovaSeq X Plus
sequencing_platform ILLUMINA
state_or_territory NSW
taxon_id 106636
team_lead_email brian.atwell@mq.edu.au
team_lead_name Brian Atwell
ticket BPAOPS-1711