Grasslands Illumina ddRAD-seq, Genotyping, Dataset ID 373572
Dataset size is: 0.00 Bit
Data and Resources
-
373572_AG_AGRF_22NTCKLT3_CTTGTA_... Metadata Only FASTQ
-
373572_AG_AGRF_22NTCKLT3_GTGAAA_... Metadata Only FASTQ
-
AG_CAGRF23120086_22NTCKLT3_Metadata.xlsx Metadata Only XLSX
-
373572_AG_AGRF_22NTCKLT3_CTTGTA_... Metadata Only FASTQ
-
373572_AG_AGRF_22NTCKLT3_ACAGTG_... Metadata Only FASTQ
-
373572_AG_AGRF_22NTCKLT3_GTGAAA_... Metadata Only FASTQ
-
373572_AG_AGRF_22NTCKLT3_ACAGTG_... Metadata Only FASTQ
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:grassland-consortium-members |
| Access Control Date | 2025-10-28 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| accession_number_seed | ? |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/grasslands/ddrad/BPAOPS-1711/20241023_AG_AGRF_22NTCKLT3/ |
| bioplatforms_dataset_id | 102.100.100/373572 |
| bioplatforms_project | Australian Grasslands Initiative (AG) |
| bpa_dataset_id | 102.100.100/373572 |
| collected_by | Brian Atwell |
| common_name | Kangaroo grass |
| country | Australia |
| data_context | Genomics - genotyping |
| data_type | ddRAD |
| dataset_url | https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1711 |
| date_of_transfer | 2024-10-28 |
| date_of_transfer_to_archive | 2024-10-29 |
| decimal_latitude_public | -33.68810173 |
| decimal_longitude_public | 151.0624105 |
| description | Illumina ddRAD-seq |
| experimental_design | PstI/HpyCH4IV |
| experimental_notes | Replicate-j |
| facility_project_code | CAGRF23120086-1 |
| family | Poaceae |
| flowcell_id | 22NTCKLT3 |
| flowcell_type | 10B |
| folder_name | 20241023_AG_AGRF_22NTCKLT3 |
| growth_condition | Low_Temperature |
| growth_facility | Macquarie University Glasshouses |
| insert_size_range | 280-375 bp |
| latitude | -33.68810173 |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2024-10-07 |
| library_prepared_by | Jeremy Beerkens |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | ddRAD |
| location_id | Sydney |
| longitude | 151.0624105 |
| metadata_revision_date | 2024-12-16 |
| metadata_revision_filename | Australian_grasslands_metadata_combined_2024-12-12_forQCIF.xlsx |
| n_libraries_pooled | 3.0 |
| plant_developmental_stage | Vegetative |
| plant_growth_medium | Soil & Potting Mix |
| plant_structure | Tussock Grass |
| preservation_date_begin | 2023-12-12 |
| preservation_storage_location | University of Tasmania |
| preservation_temperature | -80°C |
| preservation_type | Stored in nuclease free water |
| project_aim | Genotyping |
| sample_id | 102.100.100/369658 |
| sample_material_preparation_date | 2023-12-12 |
| sample_material_preparation_process | CTAB extraction with RNAse treatment |
| sample_material_preparation_type | DNA |
| sample_material_prepared_by | Jazmine Humphreys | Vinod Jacob | Alejandro Correa Lozano | University of Tasmania |
| sample_replicate | 4.0 |
| scientific_name | Themeda triandra |
| scientific_name_authorship | Forssk |
| sequencing_facility | AGRF_Melbourne |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| state_or_territory | NSW |
| taxon_id | 106636 |
| team_lead_email | brian.atwell@mq.edu.au |
| team_lead_name | Brian Atwell |
| ticket | BPAOPS-1711 |