TBD, Reference Genome, ONT-PromethION, other
Dataset size is: 0.00 b
Data and Resources
-
467215_FUN_BRF_PBC58132_ONTProme... Metadata Only TAR
-
467215_FUN_BRF_PBC58132_ONTProme... Metadata Only TAR
-
FUN_BRF_PBC58132_ONTPromethION_r... Metadata Only HTML
-
FUN_BRF_PBC58132_metadata.xlsx Metadata Only XLSX
-
FUN_BRF_PBC58132_ONTPromethION_s... Metadata Only
-
FUN_BRF_PBC58132_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
FUN_BRF_PBC58132_ONTPromethION_b... Metadata Only
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
| Access Control Date | 2026-06-10 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| altitude | 887.0 |
| analysis_software | MinKNOW 24.11.11 |
| associated_media | none |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1794/20250526_FUN_BRF_PBC58132/ |
| bioplatforms_dataset_id | 102.100.100/467824 |
| bioplatforms_library_id | 102.100.100/467215 |
| bioplatforms_project | Australian Functional Fungi Initiative |
| bioplatforms_sample_id | 102.100.100/465163 |
| ccg_jira_ticket | BPAOPS-1794 |
| cell_postion | 2H |
| class | TBD |
| collection_date | 2023-05-29 |
| collection_method | hand capture |
| collection_permit | NA |
| collector | Jonathan Arundel |
| collector_sample_id | MTBB2 γ C |
| common_name | TBD |
| country | Australia |
| data_context | Reference Genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-06-10 |
| date_of_transfer_to_archive | 2025-06-11 |
| decimal_latitude_public | -37.8393490595 |
| decimal_longitude_public | 146.2763576452 |
| depth | 0 |
| dna_treatment | Blue pippin 8 Kb size selection |
| env_broad_scale | terrestrial biome [ENVO_00000446] |
| env_local_scale | temperate rainforest biome [ENVO_01001962] |
| env_medium | plant_litter [ENVO_01000628]; humus [ENVO_01000000]; soil [ENVO_00001998] |
| experimental_design | ONT long reads |
| facility_project_code | NA |
| facility_sample_id | 932_13 |
| family | TBD |
| fast5_compression | pod5 bvz |
| flow_cell_id | PBC58132 |
| flowcell_id | PBC58132 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20250526_FUN_BRF_PBC58132 |
| genus | TBD |
| health_state | healthy |
| host_common_name | TBD |
| host_family | Nothofagaceae |
| host_organ | other |
| host_scientific_name | Nothofagus cunninghamii |
| host_status | wild |
| host_symptom | NA |
| identified_by | Jonathan Arundel |
| indigenous_location | Gunaikurnai |
| insert_size_range | 14 Kbp |
| isolate | yeast |
| library_construction_protocol | Native barcoded ligation libraries with NBD126 |
| library_id | 467215 |
| library_index_id | barcode13 |
| library_index_seq | AGAACGACTTCCATACTCGTGTGA |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 5.29 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-05-26 |
| library_prepared_by | Carolina Correa-Ospina |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ONT-PromethION |
| life_stage | cell line |
| location_info_restricted | no |
| location_text | Mount Baw Baw |
| material_conc_ng_ul | 252.0 |
| material_extracted_by | Ashley Jones |
| material_extraction_date | 2025-04-30 |
| material_extraction_method | 2 mL tube prep with 2 ball bearings, 2 min tissueLyzer. An SDS lysis buffer, cleaned with chloroform: isoamyl alcohol, bound to beads and eluted in 10 mM Tris-HCL pH 8. Full details at https://doi.org/10.1371/journal.pone.0253830 |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-25 |
| metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| n_libraries_pooled | 32.0 |
| order | TBD |
| phylum | TBD |
| project_collaborators | Itsy-Bitsy, Ashley Jones, Benjamin Schwessinger |
| project_lead | Jonathan Arundel |
| sample_collection_type | living collection |
| sample_custodian | Jonathan Arundel |
| sample_id | Itsy-Bitsy_23 |
| sample_id_description | NA |
| sample_quality | excellent |
| sample_type | single cell |
| scientific_name | TBD |
| scientific_name_authorship | TBD |
| scientific_name_note | TBD |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| source_population | NA |
| species | TBD |
| specimen_custodian | Itsy-Bitsy |
| specimen_id | 23.0 |
| specimen_id_description | sequence number of yeast sample for novel wild Australian yeasts for food and beverage production project |
| state_or_region | Victoria |
| sub_species | TBD |
| taxon_id | TBD |
| taxonomic_group | fungi |
| ticket | BPAOPS-1794 |
| tissue | other |
| tissue_preservation | Refrigeration |
| tissue_preservation_temperature | 3.0 |
| type_status | TBD |
| wild_captive | wild |
| work_order | 21028.0 |