Penicillium, Reference Genome, ONT-PromethION, Purified Penicillium spores and mycelia grown on PDA plate
Dataset size is: 0.00 b
Data and Resources
-
FUN_BRF_PBC52220_ONTPromethION_r... Metadata Only HTML
-
FUN_BRF_PBC52220_metadata.xlsx Metadata Only XLSX
-
467171_FUN_BRF_PBC52220_ONTProme... Metadata Only TAR
-
FUN_BRF_PBC52220_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
467171_FUN_BRF_PBC52220_ONTProme... Metadata Only TAR
-
FUN_BRF_PBC52220_ONTPromethION_s... Metadata Only
-
FUN_BRF_PBC52220_ONTPromethION_b... Metadata Only
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
| Access Control Date | 2026-06-23 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| altitude | NA |
| analysis_software | MinKNOW 24.11.11 |
| ancillary_notes | none |
| associated_media | Images of colonies available |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1798/20250616_FUN_BRF_PBC52220/ |
| bioplatforms_dataset_id | 102.100.100/467822 |
| bioplatforms_library_id | 102.100.100/467171 |
| bioplatforms_project | Australian Functional Fungi Initiative |
| bioplatforms_sample_id | 102.100.100/465119 |
| ccg_jira_ticket | BPAOPS-1798 |
| cell_postion | 1E |
| class | Eurotiomycetes |
| collection_date | 2022-10-21 |
| collection_method | Environment: collected rust infected leaves, kept at high humidity to promote growth then subcultured fluffy growth until a pure culture was obtained |
| collector | Jack Wess (ANU) |
| common_name | Penicillium |
| country | Australia |
| data_context | Reference Genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-06-23 |
| date_of_transfer_to_archive | 2025-06-24 |
| decimal_latitude_public | NA |
| decimal_longitude_public | NA |
| depth | NA |
| dna_treatment | Blue pippin 8 Kb size selection |
| env_broad_scale | Artificial growth conditions habitat |
| env_local_scale | Growth cabinet |
| env_medium | Stem rust infected wheat leaf |
| experimental_design | ONT long reads |
| facility_project_code | NA |
| facility_sample_id | 914-6 |
| family | Aspergillaceae |
| fast5_compression | pod5 bvz |
| flow_cell_id | PBC52220 |
| flowcell_id | PBC52220 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20250616_FUN_BRF_PBC52220 |
| genus | Penicillium |
| habitat | Controlled Environment Facility growth chamber |
| health_state | NA |
| host_common_name | Stem rust |
| host_family | Pucciniaceae |
| host_organ | NA |
| host_scientific_name | Puccinia graminis tritici |
| host_status | Cultivated |
| host_symptom | White fluffy growth |
| identified_by | Jack Wess (ANU) |
| indigenous_location | Ngunnawal and Ngambri land |
| insert_size_range | 13 Kbp |
| isolate | Sample discovered growing on stem rust pustules in planta |
| library_construction_protocol | Native barcoded ligation libraries with NBD114 |
| library_id | 467171 |
| library_index_id | barcode05 |
| library_index_seq | AAGGTTACACAAACCCTGGACAAG |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 13.2 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-06-18 |
| library_prepared_by | Carolina Correa-Ospina |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ONT-PromethION |
| life_stage | Other (mature fungal colony) |
| location_info_restricted | NA |
| location_text | The Australian National University, 46 Sullivans Creek Rd, Acton ACT 2601 |
| material_conc_ng_ul | 24.7 |
| material_extracted_by | Jack Wess |
| material_extraction_date | 2025-01-15 |
| material_extraction_method | CTAB/SDS_HMW |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-25 |
| metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| n_libraries_pooled | 9.0 |
| order | Eurotiales |
| phylum | Ascomycota |
| project_collaborators | Jack Wess |
| project_lead | John Rathjen |
| sample_collection_type | cultivated plants |
| sample_custodian | Jack Wess, Australian National University |
| sample_id | SRB_DNA |
| sample_quality | Highly pure |
| sample_type | whole organism |
| scientific_name | Penicillium sp. |
| scientific_name_authorship | Jack Wess |
| scientific_name_note | All identifications are to genus level and identified via sequencing the ITS barcode region of the fungus |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| source_population | NA |
| species | NA |
| specimen_custodian | Jack Wess, Australian National University |
| specimen_id | SRB_DNA |
| specimen_id_description | Short-hand identifier used by researcher |
| state_or_region | Australian Capital Territory |
| sub_species | NA |
| taxon_id | NA |
| taxonomic_group | Fungi |
| temperature | 22.0 |
| ticket | BPAOPS-1798 |
| tissue | Purified Penicillium spores and mycelia grown on PDA plate |
| tissue_preservation | 25% glycerol stock of pure Penicillium spores |
| tissue_preservation_temperature | -80.0 |
| type_status | NA |
| wild_captive | NA |
| work_order | 21026.0 |