Fusarium, Reference Genome, ONT-PromethION, Purified Fusarium spores and mycelia grown on PDA plate
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until June 23, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
FUN_BRF_PBC52220_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
467168_FUN_BRF_PBC52220_ONTProme... Metadata Only TAR
-
FUN_BRF_PBC52220_ONTPromethION_s... Metadata Only
-
FUN_BRF_PBC52220_ONTPromethION_r... Metadata Only HTML
-
FUN_BRF_PBC52220_ONTPromethION_b... Metadata Only
-
FUN_BRF_PBC52220_metadata.xlsx Metadata Only XLSX
-
467168_FUN_BRF_PBC52220_ONTProme... Metadata Only TAR
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
| Access Control Date | 2026-06-23 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| altitude | NA |
| analysis_software | MinKNOW 24.11.11 |
| ancillary_notes | none |
| associated_media | Images of colonies available |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1798/20250616_FUN_BRF_PBC52220/ |
| bioplatforms_dataset_id | 102.100.100/467822 |
| bioplatforms_library_id | 102.100.100/467168 |
| bioplatforms_project | Australian Functional Fungi Initiative |
| bioplatforms_sample_id | 102.100.100/465116 |
| ccg_jira_ticket | BPAOPS-1798 |
| cell_postion | 1E |
| class | Sordariomycetes |
| collection_date | 2022-03-10 |
| collection_method | Environment: collected rust infected leaves, kept at high humidity to promote growth then subcultured fluffy growth until a pure culture was obtained |
| collector | Jack Wess (ANU) |
| common_name | Fusarium |
| country | Australia |
| data_context | Reference Genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-06-23 |
| date_of_transfer_to_archive | 2025-06-24 |
| decimal_latitude_public | NA |
| decimal_longitude_public | NA |
| depth | NA |
| dna_treatment | Blue pippin 8 Kb size selection |
| env_broad_scale | Artificial growth conditions habitat |
| env_local_scale | Growth cabinet |
| env_medium | Stripe rust infected wheat leaf |
| experimental_design | ONT long reads |
| facility_project_code | NA |
| facility_sample_id | 953-1 |
| family | Nectriaceae |
| fast5_compression | pod5 bvz |
| flow_cell_id | PBC52220 |
| flowcell_id | PBC52220 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20250616_FUN_BRF_PBC52220 |
| genus | Fusarium |
| habitat | Controlled Environment Facility growth chamber |
| health_state | NA |
| host_common_name | Stripe rust |
| host_family | Pucciniaceae |
| host_organ | NA |
| host_scientific_name | Puccinia striiformis f.sp. Tritici |
| host_status | Cultivated |
| host_symptom | White/pink fluffy growth |
| identified_by | Jack Wess (ANU) |
| indigenous_location | Ngunnawal and Ngambri land |
| insert_size_range | 13 Kbp |
| isolate | Sample discovered growing on stripe rust pustules in planta |
| library_construction_protocol | Native barcoded ligation libraries with NBD114 |
| library_id | 467168 |
| library_index_id | barcode03 |
| library_index_seq | CCTGGTAACTGGGACACAAGACTC |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 13.2 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-06-18 |
| library_prepared_by | Carolina Correa-Ospina |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ONT-PromethION |
| life_stage | Other (mature fungal colony) |
| location_info_restricted | NA |
| location_text | The Australian National University, 46 Sullivans Creek Rd, Acton ACT 2601 |
| material_conc_ng_ul | 39.6 |
| material_extracted_by | Jack Wess |
| material_extraction_date | 2025-01-14 |
| material_extraction_method | CTAB/SDS_HMW |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-25 |
| metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| n_libraries_pooled | 9.0 |
| order | Hypocreales |
| phylum | Ascomycota |
| project_collaborators | Jack Wess |
| project_lead | John Rathjen |
| sample_collection_type | cultivated plants |
| sample_custodian | Jack Wess, Australian National University |
| sample_id | SRM_DNA |
| sample_quality | Highly pure |
| sample_type | whole organism |
| scientific_name | Fusarium sp. |
| scientific_name_authorship | Jack Wess |
| scientific_name_note | All identifications are to genus level and identified via sequencing the ITS barcode region of the fungus |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| source_population | NA |
| species | NA |
| specimen_custodian | Jack Wess, Australian National University |
| specimen_id | SRM_DNA |
| specimen_id_description | Short-hand identifier used by researcher |
| state_or_region | Australian Capital Territory |
| sub_species | NA |
| taxon_id | NA |
| taxonomic_group | Fungi |
| temperature | 22.0 |
| ticket | BPAOPS-1798 |
| tissue | Purified Fusarium spores and mycelia grown on PDA plate |
| tissue_preservation | 25% glycerol stock of pure Fusarium spores |
| tissue_preservation_temperature | -80.0 |
| type_status | NA |
| wild_captive | NA |
| work_order | 21026.0 |