Cladosporium, Reference Genome, ONT-PromethION, Purified Cladosporium spores and mycelia grown on PDA plate
Dataset size is: 0.00 Bit
This dataset is currently under a short embargo period until June 23, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
FUN_BRF_PBC52220_ONTPromethION_r... Metadata Only HTML
-
FUN_BRF_PBC52220_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
467167_FUN_BRF_PBC52220_ONTProme... Metadata Only TAR
-
FUN_BRF_PBC52220_metadata.xlsx Metadata Only XLSX
-
FUN_BRF_PBC52220_ONTPromethION_s... Metadata Only
-
467167_FUN_BRF_PBC52220_ONTProme... Metadata Only TAR
-
FUN_BRF_PBC52220_ONTPromethION_b... Metadata Only
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
| Access Control Date | 2026-06-23 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| altitude | NA |
| analysis_software | MinKNOW 24.11.11 |
| ancillary_notes | none |
| associated_media | Images of colonies available |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1798/20250616_FUN_BRF_PBC52220/ |
| bioplatforms_dataset_id | 102.100.100/467822 |
| bioplatforms_library_id | 102.100.100/467167 |
| bioplatforms_project | Australian Functional Fungi Initiative |
| bioplatforms_sample_id | 102.100.100/465115 |
| ccg_jira_ticket | BPAOPS-1798 |
| cell_postion | 1E |
| class | Dothideomycetes |
| collection_date | 2022-02-10 |
| collection_method | Environment: collected rust infected leaves, kept at high humidity to promote growth then subcultured fluffy growth until a pure culture was obtained |
| collector | Jack Wess (ANU) |
| common_name | Cladosporium |
| country | Australia |
| data_context | Reference Genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-06-23 |
| date_of_transfer_to_archive | 2025-06-24 |
| decimal_latitude_public | NA |
| decimal_longitude_public | NA |
| depth | NA |
| dna_treatment | Blue pippin 8 Kb size selection |
| env_broad_scale | outdoor envrionment |
| env_local_scale | Poplar trees in green space surrounding fire pit on university campus |
| env_medium | Poplar rust infected Poplar leaf |
| experimental_design | ONT long reads |
| facility_project_code | NA |
| facility_sample_id | 914-2 |
| family | Davidiellaceae |
| fast5_compression | pod5 bvz |
| flow_cell_id | PBC52220 |
| flowcell_id | PBC52220 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20250616_FUN_BRF_PBC52220 |
| genus | Cladosporium |
| habitat | Australian National University Campus |
| health_state | NA |
| host_common_name | Poplar rust |
| host_family | Melampsoraceae |
| host_organ | NA |
| host_scientific_name | Melampsora medusae |
| host_status | Wild |
| host_symptom | White fluffy growth |
| identified_by | Jack Wess (ANU) |
| indigenous_location | Ngunnawal and Ngambri land |
| insert_size_range | 13 Kbp |
| isolate | Sample discovered growing on Poplar rust pustules in planta |
| library_construction_protocol | Native barcoded ligation libraries with NBD114 |
| library_id | 467167 |
| library_index_id | barcode02 |
| library_index_seq | ACAGACGACTACAAACGGAATCGA |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 13.2 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-06-18 |
| library_prepared_by | Carolina Correa-Ospina |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ONT-PromethION |
| life_stage | Other (mature fungal colony) |
| location_info_restricted | NA |
| location_text | The Australian National University, 46 Sullivans Creek Rd, Acton ACT 2601 |
| material_conc_ng_ul | 54.9 |
| material_extracted_by | Jack Wess |
| material_extraction_date | 2025-03-20 |
| material_extraction_method | CTAB/SDS_HMW |
| material_extraction_type | DNA |
| metadata_revision_date | 2025-08-25 |
| metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| n_libraries_pooled | 9.0 |
| order | Capnodiales |
| phylum | Ascomycota |
| project_collaborators | Jack Wess |
| project_lead | John Rathjen |
| sample_collection_type | wild |
| sample_custodian | Jack Wess, Australian National University |
| sample_id | PBLUE_DNA |
| sample_quality | Highly pure |
| sample_type | whole organism |
| scientific_name | Cladosporium sp. |
| scientific_name_authorship | Jack Wess |
| scientific_name_note | All identifications are to genus level and identified via sequencing the ITS barcode region of the fungus |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| source_population | NA |
| species | NA |
| specimen_custodian | Jack Wess, Australian National University |
| specimen_id | PBLUE_DNA |
| specimen_id_description | Short-hand identifier used by researcher |
| state_or_region | Australian Capital Territory |
| sub_species | NA |
| taxon_id | NA |
| taxonomic_group | Fungi |
| temperature | 22.0 |
| ticket | BPAOPS-1798 |
| tissue | Purified Cladosporium spores and mycelia grown on PDA plate |
| tissue_preservation | 25% glycerol stock of pure Cladosporium spores |
| tissue_preservation_temperature | -80.0 |
| type_status | NA |
| wild_captive | NA |
| work_order | 21026.0 |