Unclassified Teratosphaeriaceae, reference genome, ont-promethion, NA

Teratosphaeriaceae, KMR92_DNA_LR, Fungi, Project Lead: Belinda Ferrari

Dataset size is: 0.00 b

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members
Access Control Date 2025-10-22
Access Control Mode date
Sequence Data Type ont-promethion
altitude 25.25
analysis_software MinKNOW 24.06.14
ancillary_notes Funding: AAS-4406
associated_media NA
base_url https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1708/20241017_FUN_BRF_PAW74909/
bioplatforms_dataset_id 102.100.100/467798
bioplatforms_library_id 102.100.100/465908
bioplatforms_project Australian Functional Fungi Initiative
bioplatforms_sample_id 102.100.100/463908
ccg_jira_ticket BPAOPs-1708
cell_postion 2E
class Dothideomycetes
collection_date 2019-02-16
collection_method Dry-sieving
collection_permit ATEP 18-19-4406
collector Belinda Ferrari, Catherine King, Eden Zhang, Daniel Wilkins, Mark Raymond
collector_sample_id AAD 174394
common_name Unclassified Teratosphaeriaceae
country Antarctica
data_context reference genome
data_type ONT-promethion
date_of_transfer 2024-10-22
date_of_transfer_to_archive 2024-10-24
decimal_latitude_public -66.36774
decimal_longitude_public 110.58534
depth 0.03-0.1
dna_treatment Blue pippin 10Kb size selection
env_broad_scale polar biome [ENVO_01000339]
env_local_scale polar desert biome [ENVO_01000186], cold desert [ENVO_01000382]
env_medium soil [ENVO_00001998]
experimental_design ONT long reads
facility_project_code NA
facility_sample_id ONT_gDNA132_790_1
family Teratosphaeriaceae
fast5_compression pod5 bvz
flow_cell_id PAW74909
flowcell_id PAW74909
flowcell_type FLO-PRO114M
folder_name 20241017_FUN_BRF_PAW74909
habitat polar desert biome
health_state NA
host_common_name NA
host_family NA
host_organ NA
host_scientific_name NA
host_status NA
host_symptom NA
identified_by Priyanka R. Majumdar | Nicole Benaud | Xabier Vázquez-Campos | Belinda Ferrari | Brett Summerell
indigenous_location NA
insert_size_range 29.4 Kbp
isolate KMR92
library_construction_protocol Native barcoded ligation libraries with NBD114
library_id 465908
library_index_id barcode22
library_index_seq ACCACTGCCATGTATCAAAGTACG
library_layout ONT-PromethION
library_location BRF labs
library_ng_ul 4.35
library_oligo_sequence 5' - AAGGTTAA - barcode - CAGCACCT - 3'
library_prep_date 2024-10-17
library_prepared_by Ziyan Zhang
library_selection random
library_source genomic
library_strategy WGS
library_type ont-promethion
life_stage NA
location_info_restricted no
location_text Robinson Ridge
material_conc_ng_ul unknown
material_extracted_by Priyanka R. Majumdar
material_extraction_method CTAB-based
material_extraction_type DNA
metadata_revision_date 2025-08-25
metadata_revision_filename FUN_MASTER_sample_metadata_FORDP_20250825_NOLATLON.xlsx
model_base_caller Super-accurate basecalling v4.3.0, 400 bps
movie_length 72h
n_libraries_pooled 3.0
order Mycosphaerellales
phylum Ascomycota
project_lead Belinda Ferrari
sample_collection_type Living collection
sample_custodian Belinda Ferrari (UNSW)
sample_id KMR92_DNA_LR
sample_id_description specimen_id+extracted_material(+condition+replicate)
sample_quality Excellent
sample_type Whole organism
scientific_name Unclassified Teratosphaeriaceae
scientific_name_authorship Crous & U. Braun
scientific_name_note new sp. - undescribed
sequencing_facility BRF
sequencing_kit_chemistry_version SQK-NBD114.24
sequencing_model ONT PromethION
sequencing_platform Oxford Nanopore
source_population NA
specimen_custodian Belinda Ferrari (UNSW)
specimen_id KMR92
specimen_id_description Ferrari lab fungal Internal identifier
state_or_region Eastern ANorthern Territoryarctica
taxon_id 702028.0
taxonomic_group Fungi
temperature unknown
ticket BPAOPS-1708
tissue NA
tissue_preservation NA
tissue_preservation_temperature NA
type_status NA
wild_captive Other (culture)
work_order 21017.0