Northern Spotted Rock Dtella, Reference genome, Illumina-HiC, tail muscle
Dataset size is: 0.00 b
Data and Resources
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
-
456756_AusARG_BRF_222VJYLT4_CTAC... Metadata Only FASTQ
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2023-12-29 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | no restriction |
| ala_specimen_url | NA |
| analysis_software | Bcl2Fastq |
| ancillary_notes | nana2 lineage |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1538/20231215_AusARG_BRF_222VJYLT4/20231215_AusARG_BRF_351912_222VJYLT4/ |
| bioplatforms_dataset_id | multiple (11x) |
| bioplatforms_library_id | multiple (11x) |
| bioplatforms_sample_id | multiple (11x) |
| certainty | high |
| class | Reptilia |
| collection_date | 2021-06-14 |
| collection_method | Captured by hand |
| collector | Stephen Zozaya | Leonardo Tedeschi | Jéssica Fenker | Octavio Jiménez Robles |
| collector_sample_id | CCM8057 |
| common_name | Northern Spotted Rock Dtella |
| country | Australia |
| data_context | Reference genome |
| data_custodian | Emily Roycroft |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/351912 |
| date_of_transfer | 2023-12-19 |
| date_of_transfer_to_archive | 2023-12-22 |
| decimal_latitude_public | -14.4184 |
| decimal_longitude_public | 132.21 |
| description | HiC |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| experimental_design | Arima HiC 2.0 single index |
| facility | BRF |
| facility_project_code | NA |
| facility_sample_id | 456756_AusARG_BRF_222VJYLT4_CTACCGAA |
| family | Gekkonidae |
| file_type | fastq.gz |
| flowcell_id | 222VJYLT4 |
| flowcell_type | NovaSeq X 25B |
| folder_name | 20231215_AusARG_BRF_222VJYLT4 |
| genotypic_sex | female |
| genus | Gehyra |
| identified_by | Stephen Zozaya |
| insert_size_range | ~900bp |
| institution_name | Australian National University |
| latitude | -14.4184 |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 456756 |
| library_index_id | index_9 |
| library_index_seq | CTACCGAA |
| library_layout | paierd-end |
| library_location | Freezer at BRF |
| library_ng_ul | 4.84 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTACCGAA(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 6 |
| library_pcr_reps | 1 |
| library_prep_date | 2023-11-23 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | Illumina-HiC |
| lifestage | adult |
| location_text | Katherine, near Razor Rock Farm |
| longitude | 132.21 |
| material_conc_ng_ul | NA |
| material_extracted_by | BRF ANU |
| material_extraction_method | NA |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| method_of_determination | external and internal morphology |
| n_libraries_pooled | 11 |
| order | Squamata |
| phenotypic_sex | female |
| phylum | Chordata |
| prior_genetics | NA |
| project_aim | Reference genome |
| sample_custodian | Craig Moritz |
| sample_id | 102.100.100/458266 |
| sample_quality | high |
| scientific_name | Common eastern froglet (Crinia signifera), Eungella Leaf-tailed Gecko (Phyllurus nephtys), Southern ornate nursery frog (Cophixalus australis), Gehyra sp. x8 |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | NovaSeq X series 25B 300 cycles |
| sequencing_model | Illumina NovaSeq X |
| sequencing_platform | ILLUMINA |
| source_population | NA |
| species | nana |
| specimen_id | CCM8057 |
| specimen_id_description | ANU tissue collection |
| state_or_region | Northern Territory |
| subspecies | NA |
| taxon_id | 747211 |
| taxonomic_group | lizard |
| ticket | BPAOPS-1538 |
| tissue_collection | Moritz Lab ANU |
| tissue_number | CCM8057 |
| tissue_preservation | frozen -80 |
| tissue_type | tail muscle |
| type_status | no |
| voucher_or_tissue_number | CCM8057 |
| wild_captive | wild |
| work_order | 13072 |