Ornate burrowing frog, Reference Genome, Illumina-HiC, Heart
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2023-08-20 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| ala_specimen_url | NA |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1458/20230810_AusARG_BRF_351896_HKJ33DRX3/ |
| bioplatforms_dataset_id | 351897 |
| bioplatforms_library_id | 456721 |
| bioplatforms_sample_id | 458238 |
| certainty | unknown |
| class | Amphibia |
| collection_date | 2020-12-08 |
| collector | Simon Clulow |
| collector_sample_id | SC033 |
| common_name | Ornate burrowing frog |
| country | Australia |
| data_context | Reference Genome |
| data_custodian | Renee Catullo |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/351896 |
| date_of_transfer | 2023-08-10 |
| date_of_transfer_to_archive | 2023-08-14 |
| death_date | 2020-12-21 |
| description | HiC |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| experimental_design | Arima HiC 2.0 single index |
| facility | BRF |
| facility_project_code | NA |
| facility_sample_id | 456720_AusARG_BRF_HKJ33DRX3_GACTTGAC |
| family | Limnodynastidae |
| file_type | fastq.gz |
| flowcell_id | HKJ33DRX3 |
| flowcell_type | NovaSeq 6000 SP |
| folder_name | 20230810_AusARG_BRF_351897_HKJ33DRX3 |
| genotypic_sex | not detemined |
| genus | Platyplectrum |
| identified_by | Simon Clulow |
| insert_size_range | ~1000bp |
| institution_name | University of Canberra |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 456720 |
| library_index_id | Index_13 |
| library_index_seq | GACTTGAC |
| library_layout | paired-end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.45 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGACTTGAC(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 6 |
| library_pcr_reps | 1 |
| library_prep_date | 2023-07-17 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | Illumina-HiC |
| lifestage | unknown |
| location_text | Whiporie |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| method_of_determination | Gonad |
| n_libraries_pooled | 2 |
| order | Anura |
| phenotypic_sex | Male |
| phylum | Chordata |
| prior_genetics | NA |
| project_aim | Reference genome |
| sample_custodian | Arthur George |
| sample_id | 102.100.100/458237 |
| scientific_name | Lechriodus fletcheri |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | NovaSeq v1.5 |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| source_population | NA |
| species | ornatum |
| specimen_id | SCL005 |
| state_or_region | New South Wales |
| subspecies | NA |
| taxonomic_group | frog |
| ticket | BPAOPS-1458 |
| tissue_collection | University of Canberra Wildlife Tissue Collection |
| tissue_number | SC033 |
| tissue_preservation | Snap Frozen |
| tissue_type | Heart |
| voucher_or_tissue_number | SC033 |
| wild_captive | wild-caught |
| work_order | 13066 |