Olive-headed seasnake, Reference Genome, Illumina-HiC, kidney

Hydrophiidae, Hydrophis major, SAMAR72044, snake, Project Lead: Kate Sanders

Dataset size is: 0.00 Bit

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members
Access Control Date 2021-11-07
Access Control Mode date
Sequence Data Type illumina-hic
access_rights No restrictions
ala_specimen_url https://bie.ala.org.au/species/urn:lsid:biodiversity.org.au:afd.taxon:d8f6c573-1790-4d61-8069-957c2d08708e
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1154/
bioplatforms_dataset_id 351780, 351810, 351812, 351814, 351816
bioplatforms_library_id 350845, 353995, 353996, 353997, 353998
bioplatforms_sample_id 349834, 352981, 352982, 352983, 352984
certainty High
class Lepidosauria
collection_date 2021-05-19
collection_method Wild caught from a boat at night
collector Kate Sanders | James Nankivell | Jenna Crowe-Riddell | Vinay Udywer
collector_sample_id KLS1130
common_name Olive-headed seasnake
country Australia
data_context Reference Genome
data_custodian Kate Sanders
data_type Illumina-HiC
dataset_id 102.100.100/351780
date_of_transfer 2021-10-28
date_of_transfer_to_archive 2021-10-29
death_date 2021-05-20
decimal_latitude_public -18.052242
decimal_longitude_public 122.200767
description HiC
dna_treatment FA crosllinking restriction enzymes and sonication
experimental_design Arima HiC 2.0 single index
facility BRF
facility_project_code NA
facility_sample_id 350845_HMGMJDRXY_GCCAAT
family Hydrophiidae
file_type FASTQ
flowcell_id HMGMJDRXY
flowcell_type Novaseq S1
folder_name 20211027_AusARG_BRF_HMGMJDRXY
genotypic_sex female
genus Hydrophis
habitat Marine water body
identified_by Kate Sanders | James Nankivell | Jenna Crowe-Riddell | Vinay Udywer
insert_size_range 650.0
institution_name University of Adelaide
latitude -18.052242
library_comments Concentration and size was assesd by Bioanalyzer and Qubit
library_construction_protocol Arima HiC 2.0
library_id 350845
library_index_id Index 6
library_index_seq GCCAAT
library_layout paired end
library_location Freezer at BRF
library_ng_ul 1.1
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAAT(AT)CTCGTATGCCGTCTTCTGCTTG
library_pcr_cycles 7
library_pcr_reps 1
library_prepared_by Max Nekrasov
library_selection Restriction Digest
library_source GENOMIC
library_strategy Hi-C
library_type Illumina-HiC
lifestage adult
location_text Indian Ocean, coast off Broome
longitude 122.200767
material_extracted_by Kate Sanders
material_extraction_date 2021-06-17
material_extraction_type DNA
metadata_revision_date 2024-11-15
metadata_revision_filename AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx
method_of_determination External morphology and confirmed with disection
n_libraries_pooled 5
order Squamata
phenotypic_sex female
phylum Chordata
project_aim Reference genome
sample_custodian Kate Sanders
sample_id 102.100.100/349834
sample_quality Contamination free | snap frozen
scientific_name Hydrophis major, Lampropholis delicata, Pseudemoia entrecasteauxii, Saiphos equalis, Litoria serrata
sequencing_facility BRF
sequencing_kit_chemistry_version 300 cycles
sequencing_model Illumina NovaSeq 6000
sequencing_platform ILLUMINA
source_population Australia, Western Australia, Broome
species major
specimen_id SAMAR72044
specimen_id_description South Australian Museum
state_or_region Western Australia
subspecies NA
taxon_id 355693
taxonomic_group snake
ticket BPAOPS-1154
tissue_collection Australian Biological Tissue Collection
tissue_number ABTC156318
tissue_preservation liquid nitrogen | -80
tissue_type kidney
type_status Not type specimen
voucher_or_tissue_number SAMAR72044
wild_captive wild
work_order 13026