Olive-headed seasnake, Reference Genome, Illumina-HiC, kidney
Dataset size is: 0.00 b
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2021-11-07 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | No restrictions |
| ala_specimen_url | https://bie.ala.org.au/species/urn:lsid:biodiversity.org.au:afd.taxon:d8f6c573-1790-4d61-8069-957c2d08708e |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1154/ |
| bioplatforms_dataset_id | 351780, 351810, 351812, 351814, 351816 |
| bioplatforms_library_id | 350845, 353995, 353996, 353997, 353998 |
| bioplatforms_sample_id | 349834, 352981, 352982, 352983, 352984 |
| certainty | High |
| class | Lepidosauria |
| collection_date | 2021-05-19 |
| collection_method | Wild caught from a boat at night |
| collector | Kate Sanders | James Nankivell | Jenna Crowe-Riddell | Vinay Udywer |
| collector_sample_id | KLS1130 |
| common_name | Olive-headed seasnake |
| country | Australia |
| data_context | Reference Genome |
| data_custodian | Kate Sanders |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/351780 |
| date_of_transfer | 2021-10-28 |
| date_of_transfer_to_archive | 2021-10-29 |
| death_date | 2021-05-20 |
| decimal_latitude_public | -18.052242 |
| decimal_longitude_public | 122.200767 |
| description | HiC |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| experimental_design | Arima HiC 2.0 single index |
| facility | BRF |
| facility_project_code | NA |
| facility_sample_id | 350845_HMGMJDRXY_GCCAAT |
| family | Hydrophiidae |
| file_type | FASTQ |
| flowcell_id | HMGMJDRXY |
| flowcell_type | Novaseq S1 |
| folder_name | 20211027_AusARG_BRF_HMGMJDRXY |
| genotypic_sex | female |
| genus | Hydrophis |
| habitat | Marine water body |
| identified_by | Kate Sanders | James Nankivell | Jenna Crowe-Riddell | Vinay Udywer |
| insert_size_range | 650.0 |
| institution_name | University of Adelaide |
| latitude | -18.052242 |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 350845 |
| library_index_id | Index 6 |
| library_index_seq | GCCAAT |
| library_layout | paired end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.1 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAAT(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 7 |
| library_pcr_reps | 1 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | Illumina-HiC |
| lifestage | adult |
| location_text | Indian Ocean, coast off Broome |
| longitude | 122.200767 |
| material_extracted_by | Kate Sanders |
| material_extraction_date | 2021-06-17 |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| method_of_determination | External morphology and confirmed with disection |
| n_libraries_pooled | 5 |
| order | Squamata |
| phenotypic_sex | female |
| phylum | Chordata |
| project_aim | Reference genome |
| sample_custodian | Kate Sanders |
| sample_id | 102.100.100/349834 |
| sample_quality | Contamination free | snap frozen |
| scientific_name | Hydrophis major, Lampropholis delicata, Pseudemoia entrecasteauxii, Saiphos equalis, Litoria serrata |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| source_population | Australia, Western Australia, Broome |
| species | major |
| specimen_id | SAMAR72044 |
| specimen_id_description | South Australian Museum |
| state_or_region | Western Australia |
| subspecies | NA |
| taxon_id | 355693 |
| taxonomic_group | snake |
| ticket | BPAOPS-1154 |
| tissue_collection | Australian Biological Tissue Collection |
| tissue_number | ABTC156318 |
| tissue_preservation | liquid nitrogen | -80 |
| tissue_type | kidney |
| type_status | Not type specimen |
| voucher_or_tissue_number | SAMAR72044 |
| wild_captive | wild |
| work_order | 13026 |