shingleback/sleepy lizard/bobtail, Reference Genome, Illumina-HiC, muscle structure
Dataset size is: 0.00 b
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2021-06-25 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | No restrictions |
| ala_specimen_url | NA |
| analysis_software | Bcl2Fastq |
| ancillary_notes | Animal was taken from bundey Bore Station homestead area and was put into captivity after the life in cold blood series in 2008. In regards to the common name - given this is a South Australian animal is common name is the sleepy lizard rather than shingleback or bobtail. |
| associated_media | TrG_genomeLizard1_ventral.jpg; TrG_genomeLizard1_WholeDorsal.jpg; TrG_genomeLizard2_ventral.jpg; TrG_genomeLizard1_Head.jpg; TrG_GenomeLizard_4March2020_Face.jpg |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1084/20210611_AusARG_BRF_HCN7WDRXY/ |
| bioplatforms_dataset_id | 351742 |
| bioplatforms_library_id | 350752, 350764, 350769, 350768, 350781, 350821 |
| bioplatforms_sample_id | 349751, 349763, 349765, 349764, 349775, 349811 |
| certainty | certain |
| class | Reptilia |
| collection_date | 2008-01-01 |
| collection_method | hand capture |
| collector | Dale Burzacott |
| collector_sample_id | NA |
| common_name | shingleback/sleepy lizard/bobtail |
| country | Australia |
| data_context | Reference Genome |
| data_custodian | Terry Bertozzi |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/351741 |
| date_of_transfer | 2021-06-15 |
| date_of_transfer_to_archive | 2021-06-16 |
| death_date | 2020-03-04 |
| decimal_latitude_public | -33.886547 |
| decimal_longitude_public | 139.355269 |
| description | HiC |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| experimental_design | Arima HiC 2.0 single index |
| facility | BRF |
| facility_sample_id | 350781_HCN7WDRXY_CTTGTA |
| family | Scincidae |
| file_type | FASTQ |
| flowcell_id | HCN7WDRXY |
| flowcell_type | Novaseq S1 |
| folder_name | 20210611_AusARG_BRF_HCN7WDRXY |
| genotypic_sex | male |
| genus | Tiliqua |
| habitat | xeric shrubland biome |
| identified_by | Mike Gardner |
| insert_size_range | 650.0 |
| institution_name | South Australian Museum |
| latitude | -33.886547 |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 350781 |
| library_index_id | Index 12 |
| library_index_seq | CTTGTA |
| library_layout | paired end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.2 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTA(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 8 |
| library_pcr_reps | 1 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | HiC |
| lifestage | adult |
| location_text | Bundey Bore Station homestead |
| longitude | 139.355269 |
| material_conc_ng_ul | NA |
| material_extracted_by | NA |
| material_extraction_method | NA |
| material_extraction_type | NA |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| method_of_determination | dissection and sexing marker |
| n_libraries_pooled | 6 |
| order | Squamata |
| phenotypic_sex | male |
| phylum | Chordata |
| prior_genetics | spleen transcriptome |
| project_aim | Reference genome |
| sample_custodian | Terry Bertozzi | Michael Gardner |
| sample_id | 102.100.100/349775 |
| sample_quality | excellent |
| scientific_name | Platyplectrum ornatum/Chelodina expansa/Bassiana duperreyi/Pogona vitticeps/Tiliqua rugosa/(Emydura macquarii?) |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| source_population | NA |
| species | rugosa |
| specimen_id | SAMAR71619 |
| specimen_id_description | South Australian Museum |
| state_or_region | South Australia |
| subspecies | asper |
| taxon_id | 8527 |
| taxonomic_group | lizard |
| ticket | BPAOPS-1084 |
| tissue_collection | Australian Biological Tissue Collection |
| tissue_number | ABTC151652 |
| tissue_preservation | liquid nitrogen | -80C |
| tissue_type | muscle structure |
| type_status | no |
| voucher_or_tissue_number | SAMAR71619 |
| wild_captive | wild (captive since 2008) |
| work_order | 13015 |