Eastern Three-lined Skink, Reference Genome, Illumina-HiC, liver
Dataset size is: 0.00 b
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2021-06-25 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| analysis_software | Bcl2Fastq |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1084/20210611_AusARG_BRF_HCN7WDRXY/ |
| bioplatforms_dataset_id | 351742 |
| bioplatforms_library_id | 350752, 350764, 350769, 350768, 350781, 350821 |
| bioplatforms_sample_id | 349751, 349763, 349765, 349764, 349775, 349811 |
| class | Reptilia |
| common_name | Eastern Three-lined Skink |
| data_context | Reference Genome |
| data_custodian | Arthur Georges |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/351741 |
| date_of_transfer | 2021-06-15 |
| date_of_transfer_to_archive | 2021-06-16 |
| description | HiC |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| experimental_design | Arima HiC 2.0 single index |
| facility | BRF |
| facility_sample_id | 350769_HCN7WDRXY_CAGATC |
| family | Scincidae |
| file_type | FASTQ |
| flowcell_id | HCN7WDRXY |
| flowcell_type | Novaseq S1 |
| folder_name | 20210611_AusARG_BRF_HCN7WDRXY |
| genus | Bassiana |
| insert_size_range | 650.0 |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 350769 |
| library_index_id | Index 7 |
| library_index_seq | CAGATC |
| library_layout | paired end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.2 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATC(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 8 |
| library_pcr_reps | 1 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | HiC |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| n_libraries_pooled | 6 |
| order | Squamata |
| phylum | Chordata |
| project_aim | Reference genome |
| sample_custodian | Arthur Georges |
| sample_id | 102.100.100/349765 |
| scientific_name | Platyplectrum ornatum/Chelodina expansa/Bassiana duperreyi/Pogona vitticeps/Tiliqua rugosa/(Emydura macquarii?) |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| species | duperreyi |
| subspecies | NA |
| taxon_id | 316450 |
| taxonomic_group | reptile |
| ticket | BPAOPS-1084 |
| tissue_type | liver |
| work_order | 13015 |