Ornate Burrowing Frog, Reference Genome, Illumina-HiC, Liver
Dataset size is: 0.00 b
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2021-06-21 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | No restrictions |
| ala_specimen_url | NA |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1081/20210513_AusARG_BRF_DD2M2/ |
| bioplatforms_dataset_id | 351741 |
| bioplatforms_library_id | 350752, 350764, 350769, 350768, 350781, 350821 |
| bioplatforms_sample_id | 349751, 349763, 349765, 349764, 349775, 349811 |
| certainty | certain |
| class | Amphibia |
| collection_date | 2020-12-08 |
| collection_method | by hand |
| collector | Simon Clulow |
| collector_sample_id | NA |
| common_name | Ornate Burrowing Frog |
| country | Australia |
| data_context | Reference Genome |
| data_custodian | Renee Catullo |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/351741 |
| date_of_transfer | 2021-06-11 |
| date_of_transfer_to_archive | 2021-06-11 |
| death_date | 2020-12-21 |
| decimal_latitude_public | -29.283158 |
| decimal_longitude_public | 153.013391 |
| description | HiC-QC |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| experimental_design | Arima HiC 2.0 single index |
| facility | BRF |
| facility_sample_id | 350752_DD2M2_GCCAAT |
| family | Limnodynastidae |
| file_type | FASTQ |
| flowcell_id | DD2M2 |
| flowcell_type | Miseq Nano |
| folder_name | 20210513_AusARG_BRF_DD2M2 |
| genotypic_sex | not determined |
| genus | Platyplectrum |
| identified_by | Simon Clulow |
| insert_size_range | 650.0 |
| institution_name | University of Canberra |
| latitude | -29.283158 |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 350752 |
| library_index_id | Index 6 |
| library_index_seq | GCCAAT |
| library_layout | paired end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.1 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAAT(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 8 |
| library_pcr_reps | 1 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | HiC-QC |
| lifestage | adult |
| location_text | Whiporie 1 |
| longitude | 153.013391 |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| method_of_determination | internal examination |
| n_libraries_pooled | 6 |
| order | Anura |
| phenotypic_sex | male |
| phylum | Chordata |
| prior_genetics | NA |
| project_aim | Reference genome |
| sample_custodian | Arthur Georges |
| sample_id | 102.100.100/349751 |
| sample_quality | high |
| scientific_name | Platyplectrum ornatum/Chelodina expansa/Bassiana duperreyi/Pogona vitticeps/Tiliqua rugosa/(Emydura macquarii?) |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | Illumina MiSeq |
| sequencing_platform | ILLUMINA |
| species | ornatum |
| specimen_id | SCL_006 |
| specimen_id_description | University of Canberra |
| state_or_region | New South Wales |
| subspecies | marmoratum |
| taxon_id | 2741728 |
| taxonomic_group | frog |
| ticket | BPAOPS-1081 |
| tissue_collection | Arthur Georges Lab |
| tissue_number | SC043 |
| tissue_preservation | frozen |
| tissue_type | Liver |
| type_status | no |
| voucher_or_tissue_number | SC043 |
| wild_captive | wild |
| work_order | 13015 |