Sunset Frog, Conservation genomics, Illumina ddRAD-seq
Dataset size is: 0.00 Bit
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2024-05-25 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| access_rights | Location information restricted |
| ala_specimen_url | NA |
| associated_media | yes, photographs |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/ddrad/BPAOPS-1586/20240508_AusARG_AGRF_22KKW5LT3/ |
| bpa_dataset_id | 102.100.100/351915 |
| class | Amphibia |
| collection_method | By hand |
| collector | Emily Hoffman |
| collector_sample_id | NA |
| common_name | Sunset Frog |
| country | Australia |
| data_context | Conservation genomics |
| data_custodian | Renee Catullo |
| data_type | Illumina ddRAD-seq |
| dataset_id | 102.100.100/351915 |
| date_of_transfer | 2024-05-15 |
| date_of_transfer_to_archive | 2024-05-16 |
| description | Short reads |
| experimental_design | EcoRI/MseI |
| facility_project_code | CAGRF23120080 |
| family | Myobatrachidae |
| flowcell_id | 22KKW5LT3 |
| flowcell_type | 10B |
| folder_name | 20240508_AusARG_AGRF_22KKW5LT3 |
| genotypic_sex | not determined |
| genus | Spicospina |
| habitat | Empodisma peat swamp |
| identified_by | Emily Hoffman |
| insert_size_range | 280-342 bp (narrow) |
| institution_name | University of Western Australia |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_pcr_cycles | 11 |
| library_pcr_reps | 7 |
| library_prep_date | 2024-04-12 |
| library_prepared_by | Jeremy Beerkens |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | Illumina-ddRAD |
| material_conc_ng_ul | NA |
| material_extracted_by | Renee Catullo |
| material_extraction_method | Salt/Isopropanol DNA extraction |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| n_libraries_pooled | 2.0 |
| order | Anura |
| phylum | Chordata |
| prior_genetics | NA |
| sample_custodian | Renee Catullo |
| sample_quality | unknown |
| sequencing_facility | AGRF_Melbourne |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| source_population | NA |
| species | flammocaerulea |
| specimen_id_description | Catullo_lab_ID |
| state_or_region | Western Australia |
| subspecies | NA |
| taxon_id | 356332 |
| taxonomic_group | frog |
| ticket | BPAOPS-1586 |
| tissue_collection | Catullo_lab |
| tissue_preservation | ethanol |
| type_status | NA |
| wild_captive | wild |
| work_order | 13074 |