Western Brown Snake, Phylogenomics, Illumina Capture, unknown
Dataset size is: 0.00 b
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
| Access Control Date | 2024-05-13 |
| Access Control Mode | date |
| Sequence Data Type | Illumina Capture |
| access_rights | No restrictions |
| ala_specimen_url | 228f8dc5-d40b-46a6-91a3-7fa72a092f09 |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1578/20240503_AusARG_BRF_351864_222VTMLT1/ |
| certainty | NA |
| class | Reptilia |
| collection_date | 1985-09-18 |
| collection_method | unknown |
| collector | unknown |
| collector_sample_id | unknown |
| common_name | Western Brown Snake |
| country | Australia |
| data_context | Phylogenomics |
| data_custodian | Scott Keogh |
| data_type | Illumina Capture |
| dataset_id | 102.100.100/351864 |
| date_of_transfer | 2024-05-03 |
| date_of_transfer_to_archive | 2024-05-07 |
| decimal_latitude_public | -24.88 |
| decimal_longitude_public | 113.67 |
| description | Short reads |
| dna_treatment | 5 Bioruptor cycles |
| experimental_design | Capture probes |
| facility | BRF |
| family | Elapidae |
| file_type | FASTQ |
| flowcell_id | 222VTMLT1 |
| flowcell_type | Novaseq X |
| folder_name | 20240305_AusARG_BRF_222VTMLT1 |
| genotypic_sex | not determined |
| genus | Pseudonaja |
| habitat | unknown |
| identified_by | unknown |
| insert_size_range | 150bp PE |
| institution_name | South Australian Museum |
| latitude | -24.88 |
| library_comments | NA |
| library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
| library_id | 102.100.100/455558 |
| library_index_id | p7_UDI_1142 |
| library_index_id_dual | p5_UDI_1142 |
| library_index_seq | CATCGGGACG |
| library_index_seq_dual | CGCATTACCG |
| library_layout | paired end |
| library_location | EBL Freezer |
| library_ng_ul | 1.4 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCATCGGGACGATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACCGCATTACCGACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| library_pcr_cycles | 7 |
| library_pcr_reps | 4 |
| library_prep_date | 2024-03-28 |
| library_prepared_by | Liz Broady |
| library_selection | Hybrid Selection |
| library_source | GENOMIC |
| library_strategy | Targeted-Capture |
| library_type | Exon Capture |
| lifestage | not determined |
| location_text | Carnarvon |
| longitude | 113.67 |
| material_conc_ng_ul | 22.6 |
| material_extracted_by | Liz Broady |
| material_extraction_date | 2023-02-09 |
| material_extraction_method | Salt extraction |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-11-15 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
| method_of_determination | NA |
| n_libraries_pooled | 192 |
| order | Squamata |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | unknown |
| project_aim | Phylogenomics |
| sample_custodian | Scott Keogh |
| sample_id | 102.100.100/454077 |
| sample_quality | unknown |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | NovaSeq X |
| sequencing_platform | Illumina |
| source_population | NA |
| species | mengdeni |
| species_name | Pseudonaja mengdeni |
| specimen_id | SAMA R29303 |
| specimen_id_description | South Australian Museum |
| state_or_region | Western Australia |
| subspecies | NA |
| taxon_id | 2202451 |
| taxonomic_group | Elapidae |
| ticket | BPAOPS-1578 |
| tissue_collection | Australian Biological Tissue Collection |
| tissue_number | ABTC56431 |
| tissue_preservation | ethanol |
| tissue_type | unknown |
| type_status | NA |
| voucher_or_tissue_number | R29303 |
| wild_captive | wild |
| work_order | 13078 |